1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
2 years ago
15

What is osmolarity of mammalian urine?​

Biology
2 answers:
Kruka [31]2 years ago
7 0

Explanation:

The osmolarity of mammalian urine may vary over time. The osmolarity of mammalian urine varies little between species. Mammalian urine is always hyperosmotic to blood. The osmolarity of mammalian urine may vary over time.

DanielleElmas [232]2 years ago
6 0

Answer:

The osmolarity of mammalian urine may vary over time. The osmolarity of mammalian urine varies little between species. Mammalian urine is always hyperosmotic to blood. The osmolarity of mammalian urine may vary over time.

Explanation:

I hope it will help you

You might be interested in
T is for textured
Mademuasel [1]
75% do a punnet square if you don’t understand
8 0
3 years ago
Read 2 more answers
Which process takes place last in the development of a human bean
Yuliya22 [10]

Answer:

Neurulation of organogenesis is the last stage of human development. The gastrula stage forms three germ layers called ectoderm, mesoderm, and endoderm

5 0
3 years ago
Read 2 more answers
In a certain plant, tall stems (t) are dominant to short stems (t). a farmer crosses a short-stemmed plant with a heterozygous l
melisa1 [442]

The answers would be:

Genotype                Phenotype

     Tt                      Tall stemmed

     tt                       Short stemmed

Genotypic ratio : 2:2 or 1:1

Phenotypic ratio: 2:2  or 1:1  

<u />

<u>You can read on to see how this was done:</u>

Tall stems (T) are dominant to short stems (t).

First figure out the genotypes of the parents. We have a short-stemmed plant and a heterozygous long-stemmed plant cross.

For short stem to occur, you need 2 pairs of short alleles. So the first parent would have a genotype of tt.

Heterozygous long-stemmed means that the parent has one of each allele. So the genotype of the second parent would be, Tt.

Now we can make our Punnett Square.

tt x Tt

<u>       t        t  </u>

<u>T |  Tt  |   Tt</u>

<u>t  |   tt  |   tt</u>

Let's list down the genotypes and phenotypic results.

Genotype        no.         Phenotype

     Tt                 2           Tall stemmed

     tt                  2           Short stemmed

So from that we can answer the other questions:

Genotypic ratio : 2:2 or 1:1

Phenotypic ratio: 2:2  or 1:1  

8 0
3 years ago
HELP ANSWER IS I NEED TO STUDY PLZ!<br>what are three characteristics of an invasive species​
Kamila [148]

Answer:

Harmful to the existing habitat and inhabitants

Foreign

Fast reproduction rate

7 0
2 years ago
Read 2 more answers
In your own words Describe how autotrophs and heterotrophs obtain energy. please this answer must be at least 150 words any one
blsea [12.9K]

The autotrophs are the primary producer in the food chain and they are the ones who initiate the food chain. They produce food by using sunlight or sometimes chemical energy or reactions. They primarily use carbon dioxide, sunlight and water to form sugars or carbohydrates which become their energy source. They use the process of photosynthesis or chemosynthesis to generate food. Examples of autotrophs are green plants, green algae, bacteria.

Heterotrophs cannot make their food via sunlight or other inorganic sources and hence are dependent on the autotrophs or other animals. The heterotrophs have been ranked as secondary and tertiary consumers and cannot be producers.  They consume the organic products made by autotrophs to obtain energy for various metabolic and biological activities. The heterotrophs can be herbivore, carnivore, fungi, parasitic plants.

Some are photo-hetrotrophs,  who use light as energy but cannot use carbon  dioxide as the carbon source since they cannot fix the carbon like autotrophs.

5 0
3 years ago
Other questions:
  • 15 POINTS Two puppies are born in the same litter.One has blue eyes and the other has brown eyes.Develop a hypothesis as to why
    8·2 answers
  • When under the influence of hypnosis, people are most likely to __________.
    10·2 answers
  • You expect interstitial endocrinocytes (interstitial cells of Leydig) to be rich in which of the following? Interstitial endocri
    11·1 answer
  • Scientists have discovered by looking at fossil records that the ancestors of flying squirrels did not have flight membranes and
    14·1 answer
  • Cell A has half as much DNA as cells B, C, and D in a mitotically active tissue. Cell A is most likely in
    7·2 answers
  • In what year did Robert Hooke found that cork was full of tiny chambers?
    11·1 answer
  • 1. An ecosystem is best defined as a community of living things interacting with the ________ environment
    11·1 answer
  • Which of the following describes a collection of specialized organs?
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Write a list of the words that directly intervene in the water cycle, that is, that are part of the different states that presen
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!