Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
1.) Mitosis is the splitting of a parent cell into two daughter cells. When mitosis occurs the DNA is copied, making double the amount of chromosomes in the parents cell which will late be divided into two separate cells when the cell pinches in the middle.
I believe it is option C. I know that wind plays a huge part because I live by dunes and the loose sand is constantly moving.