1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ddd [48]
3 years ago
5

NEED HELP!! WILL GIVE BRAINLIEST!! <3

Biology
2 answers:
Anni [7]3 years ago
6 0
I am unable to see the question clearly.
nevsk [136]3 years ago
4 0

Answer:

dhfoenm,

Explanation:

fhjksjurjka

You might be interested in
A population _____ follows a period of _____. decline; overshoot increase; overshoot increase; scarcity scarcity; dieback
Anna11 [10]

Answer:

Hey there!

A population increase follows a period of scarcity.

With more people, the food and water resources get scarce, and isn't always enough for everyone.

Let me know if this helps :)

5 0
3 years ago
Read 2 more answers
Which of these anatomical terms refers to the ankle?
andrezito [222]

Answer:

Tarsal

Explanation:

5 0
3 years ago
Read 2 more answers
58:22
mel-nik [20]

Answer:

The correct option is D: Faults form because crust gets cracked when plates move apart along divergent plate boundaries.

Explanation:

Options A and B are incorrect because even though tectonic plates are constantly moving and crashing against each other at convergent plate boundaries, it is not responsible for causing an earthquake. Option C is also incorrect in the context of the question statement merely colliding does not result in an earthquake.

Hope that answers the question, have a great day!

(also, please remember to give 'brainliest' if you found this answer helpful :)

6 0
3 years ago
Read 2 more answers
Identifying Biogeochemical Cycles
Naya [18.7K]

Water,Nitrogen, phosphorus and  carbon are items that are cycled through the biosphere in biogeochemical cycles.

Explanation:

  • Biogeochemical cycles maintain the balance of elements and compound in nature.
  • These help the chemical substances to circulate through different spheres of the earth.
  • They are, water cycle, sulphur cycle Nitrogen cycle, Carbon cycle ,Phosphorus cycle etc.
  • If the biogeochemical cycles were not present then elements such as nitrogen , phosphorus carbon should have got completely used up instesad of getting replenished. Thus, making several metabolism stagnant.
8 0
3 years ago
Read 2 more answers
Help me please it’s due in 20 mins
dsp73

Hello!

your answer is A.  How much energy is used to make one paper bag?

the word "should" is a giveaway of B, C, and D being questions for personal opinions. everyone has different views on what SHOULD be, so if you asked 100 people, chances are you'd get many different answers.

A can only have one possible answer.

(I don't know the answer to how much energy is used to make one paper bag so let's just leave it at that, shall we?)

I hope this helps, and have a nice day!

4 0
3 years ago
Other questions:
  • Which of the following is a value of biodiversity
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What occurs during translation?
    6·2 answers
  • Which discovery supported the endosymbiotic theory?
    13·1 answer
  • What are the male and female reproductive parts of a flower
    9·1 answer
  • HELP!!! Which of the following represent examples of how cells in multicellular organisms can communicate with each other to coo
    6·2 answers
  • Which organelles are different between animal cells &amp; plant cells? pls 45 minutes till this assignment is due
    12·2 answers
  • which star is the closest to the earth? how long does it take for light to travel from this star to earth
    12·1 answer
  • How do the specific characteristics of carbon, hydrogen and oxygen enable the
    6·1 answer
  • Is an onion structure a cell tissue organ system or organisms
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!