1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
3 years ago
14

Which is most associated with the building and repair of cells, organelles, and tissues?

Biology
2 answers:
Blababa [14]3 years ago
6 0
..........The answer is D
KIM [24]3 years ago
5 0

Answer:

Hi... Your answer is D...

You might be interested in
I need help on this biology question
vichka [17]

Limiting factors for snakes can include frogs, grasshoppers, farmers, pesticides, weather, climate, the environment, and various other abiotic and biotic factors.

Those specified however were also specified within the prompt. These are limiting factors because they can limit or help excel the snake population growth, yet in this prompt it is shown to greatly diminish the growth.

Hope this helps!

8 0
4 years ago
In telophase of mitosis, the mitotic spindle breaks down and a nuclear envelope forms. this is essentially the opposite of what
makkiz [27]
<span>In telophase of mitosis, the mitotic spindle breaks down and a nuclear envelope forms. this is essentially the opposite of what happens in interphase.
</span><span>
</span>
3 0
4 years ago
What are the products of cellular respiration
Shkiper50 [21]

Answer:

Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

5 0
3 years ago
1 pts A woman with Type B blood who's father was Type O blood marries a man with Type AB blood. What are the possible blood type
Naddika [18.5K]

Answer:

The children can have all of the following, AB, A and B.

Explanation:

Within a Punnett square, BO and AB can only make AB, Ao, BB and BO.

4 0
3 years ago
On early Earth , what was referred to as the " primordial soup
Andreyy89
The answer should be the combination of organic compounds in warm salty water.
3 0
3 years ago
Other questions:
  • In exocytosis, the membrane package fuses with _____.
    6·1 answer
  • Membrane proteins of hamster cells were marked with a blue dye and membrane proteins of human cells were marked with a green dye
    13·1 answer
  • A 25-year-old athlete reports a sudden popping sound in the knee. this results in difficulty with weight bearing and acute swell
    7·2 answers
  • Which type of power generation can cause air pollution?​
    13·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • Roger is studying how energy from the Sun changes to chemical energy in plants and to mechanical energy in animals. He is studyi
    15·2 answers
  • *EARTH SCIENCE CLASS*
    6·1 answer
  • Hey can you help me with these questions
    14·1 answer
  • A cell containing 15% salt is placed in a 55% salt solution. If osmosis takes place, which statement below correctly describes t
    6·1 answer
  • Series of choices between two characteristics that is used to identify organisms is called a
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!