1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DiKsa [7]
3 years ago
11

Help me please!!!!!!!! :( Past due!!!! No websites/ links/ inappropriate answers or your reported. Worth 20 points please look a

t all images! Which picture should I use to seem that my hypothesis is inclusive? And please explain why that specific picture

Biology
1 answer:
Westkost [7]3 years ago
3 0

answer : i suppose the second one is better due to its more in deep explanation hope my opinion helps you

You might be interested in
How long are dogs pregnant?
zhannawk [14.2K]
It's 58 to 68 days
It is known as Gestation period
3 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
What's the source code of transcription
Vadim26 [7]
The source code of transcription is mRNA.
6 0
3 years ago
Read 2 more answers
State one similarity and one difference between the responses of tropism and mastic movement.
Amanda [17]

Explanation:

The similarity between tropic and nastic movement is - both are the result of external stimulus and the difference between tropic and nastic movement is the direction of the response is not dependent on the direction of the stimulus in the case of nastic movement but in the case of tropic movement, the response is dependent on the moment.

7 0
2 years ago
List the six nitrogen bases that would pair with the following sequence of bases in a strand of DNA: T C G A C A
nirvana33 [79]
Answer:
A G C T G T

Explanation:
each base has an opposite:
A and T are opposites
C and G are opposites
7 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to the natural gases collected from a sanitary landfill?
    9·2 answers
  • Which is part of meiosis but not mitosis
    13·1 answer
  • Like animals, plants must maintain an internal balance, or _____.
    11·1 answer
  • What is produced by the process of meiosis?. . A.. two diploid cells. . B.. four diploid cells. . C.. two haploid cells. . D.. f
    10·2 answers
  • On which bone does Sella Turcica occurs?
    10·1 answer
  • Which cross shows both parents having two different alleles for each of two different genes?
    15·1 answer
  • Help please due in twenty minutes. Will mark branliest
    9·2 answers
  • Select all the correct answers.
    10·1 answer
  • Reproductive system brain pop Worksheet<br><br> Help please?
    11·1 answer
  • Translate this to an equation.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!