1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kumpel [21]
3 years ago
6

Help please will mark brainliest.

Biology
1 answer:
IrinaK [193]3 years ago
3 0

Answer:8.6

Explanation:

You might be interested in
Some (blank) transport materials into and out of the cell.
padilas [110]
The answer is c, lipids, :)
7 0
3 years ago
Read 2 more answers
Use the drop-down menus to complete each statement about contour lines.
Rudiy27

Answer: elevation, index, contour interval

Explanation:

7 0
3 years ago
Read 2 more answers
Why didnt Andrew Jackson win the Election of 1824 A.) he had fewer electoral votes than John B.) he was betrayed by John C.) he
Bess [88]
B is the correct answer I think
3 0
3 years ago
Which of these activities are ways people degrade commons? Select the two correct responses.
statuscvo [17]
<span>Which of these activities are ways people degrade commons? Select the two correct responses.

</span>
<span>A. Farmers allow livestock to overgraze federal pastureland.
                                       AND
</span>
<span>D. Hunters hunt a valued species to extinction. </span>
3 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • Which of the following accurately describes the process of translation? A. The process continues until a ribosome reaches UAA, U
    7·2 answers
  • Which organelle is responsible for synthesizing proteins? which organelle is responsible for synthesizing proteins? golgi appara
    7·1 answer
  • Which of the following is the muscle protein that binds and stores oxygen to maintain aerobic conditions in actively contracting
    6·1 answer
  • Which of the following has mechanical energy?
    6·2 answers
  • Which statement about chargaff rules is correct
    14·1 answer
  • Organisms use different types of adaptations to aid in their survival.Some mushrooms are poisonous to organisms that eat them. W
    10·2 answers
  • Do you agree with Nature or Nurture or both?why
    15·1 answer
  • An environment that provides the things a specific organism needs to live, grow and reproduce is its _______
    10·2 answers
  • PLEEAASE HELP due today and i dont get it. &lt;3 thnxx
    11·1 answer
  • Define and give an example of conduction and convection
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!