Answer:
Explanation:
1)Pfr/Pr
2) Pr
3)far-red
Explanation:
The leaves at the top of a tree’s canopy are exposed to direct sunlight during the day, and their phytochromes will occur in a high *Pfr/Pr* ratio. Meanwhile, the leaves of the same tree at the bottom of the canopy are highly shaded during the day and will likely have a higher proportion of the * ( PHYTOCHROME )Pr *;form of phytochrome present due to exposure to a higher proportion of *FAR RED * light.
Plants make use of the phytochrome system to it's adjust growth based on the seasons. Through phytochrome plants is able to respond to the timing and duration of dark and light periods. At dawn, all the phytochrome molecules present in the leaved are converted to the active Pfr form until sunset this is because the sun is unfiltered, and unfiltered sunlight has high percentage of red light, but lower far-red light, with the help of phytochrome system , the plants is able to compare the length of dark periods over several days.
Tropical rainforest is a biome which is warm and wet, with little seasonal variation in temperature and frequent precipitation.
<h3>What is a Biome?</h3>
This is referred to an environment which has features such as being greatly influenced by abiotic factors such as sunlight, water etc.
Tropical rainforest as the name implies has a large and frequent amount of precipitation thereby making it wet with little seasonal variation in temperature. It is also characterized by large trees which form canopies in the region.
Read more about Tropical rainforest here brainly.com/question/1146251
#SPJ1
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Explanation:
Un cambio en la secuencia de bases en el ADN o ARN se conoce como mutación . ¿La palabra mutación te hace pensar en ciencia ficción y monstruos con ojos de insecto? Piensa de nuevo. Todos tienen mutaciones. De hecho, la mayoría de las personas tienen decenas o hasta cientos de mutaciones en su ADN. Las mutaciones son esenciales para que ocurra la evolución. Son la fuente principal de todo el material genético nuevo -nuevos alelos - en una especie. Aunque la mayoría de las mutaciones no tienen efectos en los organismos en que ocurren, algunas mutaciones son beneficiosas. Incluso las mutaciones dañinas rara vez causan cambios drásticos en los organismos.