1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vichka [17]
3 years ago
6

A range of is basic. * Between 0 and 6.9 Between 7.1 and 14 7 O 14

Biology
2 answers:
bazaltina [42]3 years ago
6 0

Answer:

7.1 and 14 is basic

Explanation:

0 - 6.9 is acidic.

7 is neutral

14 is basic but its not a range.

Nady [450]3 years ago
4 0
7.1 and 14 is the answer
You might be interested in
Sometimes we call "clean energy"<br> *<br> A) Fossil fuels B) Petroleum C) green energy
m_a_m_a [10]
Answer:
C) Green energy
7 0
3 years ago
Chelsea is a chemist working with a research company trying to create a treatment for Alzheimer’s. Chelsea knows that this is a
s344n2d4d5 [400]

Answer:

I'm thinking observation vs inference

Explanation:

she does her research about the situation and then comes up with an idea. the idea can be seen as an inference since at the end of the article it says "proving to be more impossible than not", which leads me to believe it's more of an observation vs inference situation.

5 0
3 years ago
A ________ is a model that imitates a real-world situation. What goes in the blank? Also my other question is, A _________ is an
Marina CMI [18]
First one is Model and second one is Inference
8 0
3 years ago
There are varying levels of light in the ocean. Research and describe any one adaptation that helps ocean organisms to stay near
Fantom [35]

Answer:

sunlight entering the water may travel about 1,000 meters (3,280 feet) into the ocean under the right conditions, but there is rarely any significant light beyond 200 meters (656 feet). The ocean is divided into three zones based on depth and light level. The upper 200 meters (656 feet) of the ocean is called the euphotic, or "sunlight," zone.

Explanation:

hope this helps

5 0
2 years ago
A good scientifific blank can be repeated by someone else and the same results will be found
Mice21 [21]
ANSWER SOMEBODY DDFRF
6 0
1 year ago
Other questions:
  • Which of the following best compares mosses and ferns?
    12·2 answers
  • Scientists can determine the direction a glacier traveled by examining:
    8·1 answer
  • Which of the following ia a main goal of a species survival Plan
    6·1 answer
  • 65 million years ago, a large asteroid collided with the
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is the biggest difference between those individuals with body dysmorphic disorder and those individuals who are unhappy wit
    6·1 answer
  • HURRYYY !!!! <br> Which statement describes how technology has increased our information on mars ?
    14·2 answers
  • Which best describes the relationship between evolution and natural selection?
    9·2 answers
  • Why would an athlete need to be concerned about a twitch or sustained contraction​
    11·2 answers
  • Are data that do not support a hypothesis useful?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!