1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
14

Explain how the water vascular system allows an echinoderm to move along the ocean floor. Please help!

Biology
2 answers:
meriva3 years ago
4 0

Water gets into the water vascular system through an opening in the echinoderm's body. When the animal contracts its muscles, the water is forced through the system and into the tube feet. The tube feet act as suction cups, gripping the surface below. When the echinoderm retracts its muscles, the tube feet retract and let go of the surface. This series of contractions and retractions allows the animal to move along the ocean floor.

edge

astra-53 [7]3 years ago
3 0

Answer: Sea stars move using a water vascular system. Water comes into the system via the madreporite. It is then circulated from the stone canal to the ring canal and into the radial canals.

Explanation: The radial canals carry water to the ampullae and provide suction to the tube feet.

You might be interested in
I NEEEEEDDDD HELP PLEASEEE
Novay_Z [31]
The skin regulates body temperature with its blood supply.

and sensory receptor found in the dermis or epidermis. They are a part of the somatosensory system.
5 0
2 years ago
Which cell moves dust out of the body
nalin [4]

Answer:

Ciliated is the cell that moves dust particles out the body

Explanation:

3 0
3 years ago
Hypothesis: If i add the egg to vinegar then the shell will dissolve within 24 hours
nadezda [96]

Answer :

Vinegar is a weak acid. This is used to make a naked egg. When an egg is added in the vinegar for one day / 24 hrs, it reacts with the eggshell.  The calcium carbonate shell gets dissolve.

Then an egg without shell is formed and the size of the egg does not change. The calcium carbonate reacts with acetic acid and forms carbon dioxide.

When the shell-less egg is kept in the vinegar for 48 hrs i.e. 2 days again, the water content in it enters into the eggs through the membrane. Then the egg gets somewhat bigger.

Otherwise, for 24 hrs, vinegar is acting like an isotonic solution and only dissolves the shell. This experiment would be done for showing the osmosis process through the cell membrane.

6 0
3 years ago
Is energy lost by catabolism or anabolism?​
Darina [25.2K]

Explanation:

Anabolism requires energy to grow and build. Catabolism uses energy to break down. These metabolic processes work together in all living organisms to do things like produce energy and repair cells.

Catabolic reactions release energy, while anabolic reactions use up energy.

<em>The best way to get started is to quit talking and begin doing</em>

<h2 />
3 0
3 years ago
Natural selection is based on Darwin’s observation that individuals most likely to survive and reproduce are those _____.
mariarad [96]

Answer:

Explanation:

Natural selection is based on Darwin’s observation that individuals most likely to survive and reproduce are those with traits best suited to their current environment.

8 0
3 years ago
Other questions:
  • Paint and solvents pose no potential hazard to human health. Please select the best answer from the choices provided T F
    6·1 answer
  • Short note about autocrine
    8·1 answer
  • What do light-independent reactions use in order to form sugars?
    6·1 answer
  • Which statement describes DNA?
    8·1 answer
  • A client with a fractured tibia and fibula is to be discharged from the emergency department with a right leg cast and crutches.
    9·1 answer
  • Which of the following is NOT a skill scientists use to learn about the world?
    5·1 answer
  • Do the internal environments of males and female differ
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Explain how the energy of a marble is transformed as it rolls down a ramp. Give evidence that energy of the marble remains the s
    6·2 answers
  • 7. Indicate which stage of mitosis is occurring in each of the images above and describe what is
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!