1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
What is the correct definition of antibodies?
Softa [21]

Answer: The answer is  C

Explanation:

 Antibodies or otherwise called Immunoglobulin are special protein that are produced by certain lymphocytes which produces antibodies which can affect the invading bacteria or other foreign  bodies called the antigens  or other toxins in a number of ways . Certain antibodies known as agglutinins make bacteria harmless by causing them to clump together. The lysins dissolve the outer coats of bacteria, the antitoxin neutralize the toxin of bacteria  while precipitins precipitate the toxin as insoluble and therefore , convert them to a harmless compound. Antibodies are always produced by the immune system.

4 0
3 years ago
Read 2 more answers
After the egg is fertilized what type of cell division occurs
kotegsom [21]
I guess Mitosis.........
6 0
3 years ago
Which of the following is an example of competition that could be found int the ocean
Elena-2011 [213]
It would be shark againts fish i think

4 0
3 years ago
Read 2 more answers
How is a brain injury classified?
faltersainse [42]

Answer:

As an injury of the central nervous system.

Explanation:

Peripheral nervous system is the nervous system outside the brain and spinal cord. The central nervous system consists of the brain and spinal cord. The autonomic nervous system is a control system that acts largely unconsciously and regulates bodily functions, such as the heart rate, digestion, respiratory rate, and more. The somatic nervous system is the part of the peripheral nervous system associated with the voluntary control of body movements via skeletal muscles. Therefore, central nervous system is your answer!

Hope this helps :3

6 0
3 years ago
Read 2 more answers
The cell walls of fungi are different than the cell walls of plants because they contain? A)The hard material of chitin B) Pores
torisob [31]
Fungi cell walls are made of chitin and other polysaccharides, not cellulose (Plants) or protein (Animals). Therefore your answer is-
 
"The cell walls of fungi are different than the cell walls of plants because they contain the hard material of chitin"
5 0
3 years ago
Other questions:
  • 13. a liver cell and a nerve cell in you body has the same dna. why does the liver cell have different structures and functions
    7·1 answer
  • Describe a major distinction between most plant cells and animal cells
    14·1 answer
  • Choose the plants from the following list that you would find in the lower shore area of the rocky shore.
    12·1 answer
  • WILL GIVE BRAINLIEST!!
    12·1 answer
  • Alleles are described as ____________________. homologous chromosomes homologous chromosomes alternate versions of a gene altern
    14·1 answer
  • Describe the process of transferring from photosynthesis to respiration
    9·1 answer
  • Can you please help me pls?
    15·1 answer
  • GATTACA Movie Conclusion
    11·1 answer
  • 2. Which type(s) of cells have genetic material that is contained in a nucleus?
    9·2 answers
  • Compare the costs and benefits of living in a group of animals.​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!