1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
Type the half-cell reaction that takes place at the anode for the cobalt-silver voltaic cell. Indicate the physical states of at
VashaNatasha [74]

Answer:

Co(s)→Co3+(aq)+3e−

Explanation:

The half-cell reaction may be defied as the reaction taking place at an individual anode or cathode. The oxidation and reduction reactions occur at the electrodes.

Oxidation reaction occur at anode and reduction reaction at cathode. The half-cell reaction for cobalt silver voltaic cell, the oxidation of cobalt occurs at anode. The cobalt loses its 3 electrons and converted to aqueous state from the solid state.

Thus, the reaction at anode is Co(s)→Co3+(aq)+3e− .

4 0
4 years ago
Energy-producing organelles are the _____. ribosomes mitochondria lysosomes nuclei
Vladimir [108]
The mitochondria is the answer. Cellular respiration (which is the process of producing ATP (adenosine triphosphate) from glucose) in eukaryotic cells, occurs in the mitochondria organelle.
8 0
4 years ago
Read 2 more answers
How many days in a year ?
krok68 [10]

Answer:

365 days

Explanation:

5 0
4 years ago
Read 2 more answers
Translate the mRNA codons into the
padilas [110]

Answer:

mRNA sequence: AUG; GCU; AAU; UGU; UGA

protein sequence: Met-Ala-Asn-Cys-stop codon (Methionine-Alanine-Asparagine-Cysteine-stop codon)

Explanation:

Transcription is the process by which a fragment of DNA (e.g., a gene) is used as template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence that is then used to synthesize a protein by the process of translation. In RNA, Adenine bases are replaced by Uracil bases. During translation, each codon (i.e., each triplet of nucleotides of the mRNA) indicates a specific amino acid (according to the genetic code).  UGA, UAA, and UAG are stop codons that signal the end or termination of translation.

4 0
3 years ago
To test how fertilizer affects tomato plants, a farmer divided a field of young
Dmitriy789 [7]

Answer:

The plots with no fertilizer

Explanation:

In an experiment, the control group is used as a comparison for the experimental group (the group being actively changed and observed).

So, in this experiment, the control group is the plots with no fertilizer.

This acts as a good control group because it provides a normal standard to show the effect of fertilizer on the tomato plants.

So, the control group in this experiment are the plots with no fertilizer.

7 0
3 years ago
Other questions:
  • Which of the following serve as antibodies? carbohydrates lipids nucleic acids proteins
    10·2 answers
  • Mammals that give birth to under-developed young that must continue developing in a pouch-like structure are termed
    15·2 answers
  • A heat source could be considered a source of pollution.. Please select the best answer from the choices provided T F
    14·1 answer
  • Which is the first enzyme used in the production of cdna?
    10·1 answer
  • What are plasmids? enzymes that cut DNA enzymes that bond genetic material together small rings of bacterial DNA simple organism
    9·1 answer
  • How are combustion and cellular respiration similar?
    9·1 answer
  • This is a 5-carbon sugar which is a structural component of rna
    6·1 answer
  • Soaps can be produced by using bases to dissolve fats or oils. Ammonia feels slippery or soapy to the touch because ________. Gr
    8·1 answer
  • Is a fossil a biotic or abiotic factor? Explain why or why not.*<br> 2 points<br> Your answer
    11·2 answers
  • What does it mean for a bacteria or protist to be photosynthetic?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!