1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
New membrane phospholipids are synthesized by enzymes bound to the _____________ side of the _________________ membrane. a. lumi
JulsSmile [24]

Answer:

The correct option is C) cytosolic, endoplasmic reticulum

<em>New membrane phospholipids are synthesized by enzymes bound to the cytosolic side of the endoplasmic reticulum membrane.  </em>

Explanation:

Synthesis of proteins that are destined to membrane or exportation starts in the cytoplasm with the production of a molecule portion known as a signal aminoacidic sequence. This signal sequence is located in the amino extreme of the synthesizing protein, and when it reaches a certain length, it meets the signal recognizing particle. This particle joins the signal sequence of the protein and leads the synthesizing protein and associated ribosome to a specific region in the Rough endoplasmic reticulum where it continues the protein building. When they reach the membrane of the endoplasmic reticulum, the signal recognizing particle links to a receptor associated with a pore. Meanwhile, the ribosome keeps synthesizing the protein, and the enlarged polypeptide chain goes forward the reticulum lumen through the pore. While this is happening, another enzyme cuts the signal sequence, an action that requires energy from the ATP hydrolysis. When the new protein synthesis is complete, the polypeptide is released into the reticulum lumen. Here it also happens the protein folding (which is possible by the formation of disulfide bridges of proteins are formed) and the initial stages of glycosylation (the oligosaccharide addition).  The newly synthesized proteins get packaged into vesicles that take them to the Golgi apparatus.

In the Golgi complex, proteins suffer their final association with carbohydrates and lipids to originate glycoproteins and glycolipids. Once these processes are done, the glycoproteins and glycolipids are packaged again into new vesicles that drive them to their final destiny.

3 0
3 years ago
What soil is under rainforest
frutty [35]
Thin layer of decaying organic matter is found. Years of weathering washed most of the nutrients away.
5 0
4 years ago
Match the following terms and definitions.
patriot [66]
<h2>(Answer 1 points 3)</h2><h2>A. Taxon</h2><h3>3. the categories used in classifying organisms.</h3><h2>Explanation:</h2>

In other words, we can also say that taxon is also known as a taxonomic group of any rank, such as a species, family, or class. It is a group of one or more than one different populations of an organism or the organisms viewed by taxonomists to make a system. These are the rules for naming new animals.

<h2>(Answer 2 points 3)</h2><h2>B. Taxonomy</h2><h3>1. the science of the classification of organisms.</h3><h2>Explanation:</h2>

A taxonomy is said to be a scheme of classification or in other words, we can also define the term taxonomy as the branch of science involved with classification, especially of organisms, systematics. Organisms are grouped together. This science of gives name, describe and classify the organisms including all the plants, animals and the microorganisms of the world.

<h2>(Answer 3 points 3)</h2><h2>C. Family</h2><h3>4. A taxonomic category containing a group of similar genera.</h3><h2>Explanation:</h2>

Family is the one that has been classified between order and genus. A family is also divided into the subfamilies. It is one of the eight main and important taxonomic levels. It is a primary taxonomic category of organisms ranking. This category comes on the sixth number of all the categories lies in a taxonomic group.

<h2>(Answer 4 points 3)</h2><h2>D. domain</h2><h3>2. The largest taxonomic category.</h3><h2>Explanation:</h2>

In the three-domain system of taxonomy, if we talk about the domain then we would define it as the superkingdom or empire. It can also be said to be as it is the highest taxonomic rank of organisms. It is a taxonomic category above the kingdom level. There are three domain such as Bacteria, Archean, and Eukarya, which we can say are the major categories of life.


4 0
4 years ago
Typically, nitrogen atoms are composed of seven electrons, seven protons, and seven
antoniya [11.8K]

Answer:

d. have more than seven neutrons.

3 0
4 years ago
What effect does a quadrupling of the mass have upon the acceleration of the object ?
Marizza181 [45]
Mass does<span> not </span>affect<span> the </span>acceleration<span> due to gravity in any measurable way. The two quantities are independent of one another. Light </span>objects<span> accelerate more slowly than heavy </span>objects<span> only when forces other than gravity are also at work. When this happens, an </span>object<span> may be falling, but it is not in free fall.

Mass does matter when pointed in a downward angle, like if you have a metal toy car racing down a large peice of wood at a downward angle. If you had a plasitic car aong side it to measure which would go faster the metal car will reach the bottom quicker, gravity weighs down things :)</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • What’s process takes place when mid ocean ridges
    7·1 answer
  • The DNA double Helex can be tightly coiled around proteins to form a?
    12·2 answers
  • What is the role of ATP in the cell? (1 point)
    12·2 answers
  • You should dedicate _______ of your dinner plate to protein-rich foods.
    7·2 answers
  • Which statement is true?
    12·2 answers
  • In the United States, nuclear energy provides which percentage of U.S. energy needs? 8% 22% 53% 74%
    5·2 answers
  • What is the k-t extinction?
    15·2 answers
  • Identify the structures from the image. <br><br>A - <br>B - <br>C - <br>D - <br>E -<br>F -​
    10·1 answer
  • If an invasive species emigrated from a continent to a small island near the continent, what would most likely occur on the isla
    14·1 answer
  • How is water and food transported around the plants
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!