1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
Describe the chemical and physical structure and parts of a gene.
Wittaler [7]
Double helix my demon
4 0
3 years ago
Is examination of the back an organ or body area examimnation?
maks197457 [2]
I believe it's the body area examination, since a 'back' isn't and organ

Hope this helpss
6 0
3 years ago
Whales are thought to have evolved from land animals similar to large otters. as evidence of this, whales have useless leg bones
Viktor [21]
It is a vestigial structure
6 0
3 years ago
Where do trees get nutrients to grow
emmainna [20.7K]

Answer:

Photosynthesis a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities

they need sun water and CO2

Explanation:

4 0
2 years ago
Why is innate host resistance a type of nonspecific immune response?.
ASHA 777 [7]

These defenses are described as nonspecific because they do not target any specific pathogen; rather, they defend against a wide range of potential pathogens.

<h3>Is innate immunity nonspecific resistance?</h3>

The innate immune system provides this kind of nonspecific protection through a number of defense mechanisms, which include physical barriers such as the skin, chemical barriers such as antimicrobial proteins that harm or destroy invaders, and cells that attack foreign cells and body cells harbouring infectious agents.

Thus,  they do not target any specific pathogen; rather, they defend against a wide range of potential pathogens.

To learn more about nonspecific resistance click here:

brainly.com/question/14706824

#SPJ1

6 0
2 years ago
Other questions:
  • 16) __________ memory holds information for 15 to 25 seconds and stores it according to its meaning rather than as mere stimulat
    14·1 answer
  • Identify two or three additional nutrients that are found in foods that contain complex carbohydrates
    8·1 answer
  • In what ways are herbivores and carnivores alike
    7·2 answers
  • 1. All genes are not "on" all the time. Using the metabolic needs of E. coli, explain why not. 2. What are the two main ways of
    13·1 answer
  • What types of proteins embedded within the cell membrane
    12·2 answers
  • How do we use relative dating to determine the age of a fossil, artifact, or rock layer?
    11·1 answer
  • Who was the thief of the money? How did you determine this? Include what the thief's potential motive may have been for stealing
    8·1 answer
  • Ninhydrin is used on a latent print to detect
    13·1 answer
  • A theme is a(n)___musical idea<br><br>A. shortened<br>B. complete <br>C. partial<br>D. staccato<br>​
    11·2 answers
  • What happens to animals born with a change in species numbers ?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!