1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
9. Which is not associated with areas of karst topography? A caverns B sinkholes C flowing rivers D sinking streams​
Lesechka [4]
A carerns. I think not 100
5 0
2 years ago
Use the needleman-wunsch algorithm to find the raw score for comparison of the following sequences. rank them from the most like
lana66690 [7]

Answer: B. TEFKAGSAKGATLFKTRCLQ

D. TEFKAGSAKGATLFKTRCLQ

A.TEFKAGSAKKGATLFKTRCLQ

E. TEFKAGSAKKKGAGATLFKTRCLQ

C. TEFKAGSAKLGATLFKTRCLQ

Explanation:

3 0
3 years ago
Please help
-BARSIC- [3]
Around 40%

hope this helps!!!
7 0
3 years ago
Read 2 more answers
If steel is more dense than lake water, why can a boat float? the average density of the boat, including the steel and air, is l
sergejj [24]
Or <span>The average density of the boat, including the steel and air, is less dense than 1.00 g/cm³..</span>
4 0
4 years ago
Read 2 more answers
How and why might the R0 value change over time during an outbreak? pls help
Stolb23 [73]

Answer:

Vaccinations

Explanation:

For example, if a disease has an R0 of 18, a person who has the disease will transmit it to an average of 18 other people. That replication will continue if no one has been vaccinated against the disease or is already immune to it in their community. So if you have (for example) a vaccination then you're less likely to get it, resulting in a lower R0

6 0
2 years ago
Other questions:
  • What produces variable traits depending on environmental conditions
    14·1 answer
  • Two species of meadowlark have different mating calls that lead to reproductive isolation. What type of isolation does this exam
    14·2 answers
  • A client in a mental health facility is demonstrating manic-type behavior by being demanding and hyperactive. what is the nurse’
    11·2 answers
  • Where does diffusion take place in the body?
    7·2 answers
  • A student views the image of a cell magnified 40000 times the image is 50mm long calculate the actual length of the sample in mi
    12·1 answer
  • cells have different external structures, such as cilia, pseudopods, and flagella. What function do these structures share? What
    6·1 answer
  • How much acid is in the world
    5·2 answers
  • Which of the following is an example of evidence from comparative embryology that supports biological evolution?
    12·1 answer
  • What can cause the physical weathering of rock? A. water B. wind C. heat D. all of the above
    12·1 answer
  • Compare the Early Earth's Atmosphere to today's Atmosphere. What change in the atmospheric conditions impacted life on earth the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!