1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
Which of the following are individual components of a cell that operate like microscopic organs to keep a cell healthy.
Len [333]

Answer:

i think it is organelles

5 0
3 years ago
Why don't antibiotic work on viruses?
Aleksandr [31]
Antibiotics are meant to kill living things (bacteria). Viruses, on the other hand, we are not sure if they would classify as living. Viruses change the meaning of "life" if we consider them alive. They can <em>only </em>reproduce within another cell by taking over that cell. An antibiotic would have to be able to kill human cells to kill a virus, and that would not be a good medicine to take. Viruses invade a host cell and incorporate the virus DNA into the host cell's DNA, which would cause the host cell to create more viruses to invade other cells. <span />
8 0
3 years ago
A(n) is a molecule, cell, or organ that directly carries out a response to a stimulus and restores homeostasis.
anastassius [24]

Answer:

Red blood cells and the heart causes response to stimuli

3 0
2 years ago
Where are amphibians who eat livingplants most likely to live in a lake
goldfiish [28.3K]

Answer:

the littoral zone

Explanation:

5 0
3 years ago
How do observations relate to hypothesis
Umnica [9.8K]
The hypothesis is what you think before you get your result so observations can  influence your hypothesis
8 0
3 years ago
Other questions:
  • Which of these substances is a compound?
    9·2 answers
  • The ____ will store pigments and toxins in plant cells.
    7·2 answers
  • Which statement best describes the similarity between the recessive allele and the dominant allele?
    6·1 answer
  • What happens to macromoleclues from food during digestion
    8·2 answers
  • Which fungi are enclosed by cell walls containing the polysaccharide
    13·1 answer
  • The environmental protection agency's new mercury and air toxics standards are projected to reduce emissions of these toxic subs
    12·1 answer
  • A stem cell is
    12·2 answers
  • What type of bird egg is this btw i live in sc i found it in my backyard my dog was about to step on it
    10·2 answers
  • Which of the following best describes how amino acids affect the tertiary structure of a protein?
    15·1 answer
  • Compare the plant embryo to the animal embryo. Can you make inferences about the evolutionary relationship between animals and p
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!