1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
The easiest type of business to start is a sole proprietorship
klio [65]

Answer:

There is no correct answer.

Explanation:

Different circumstances regarding how you operate your company and what kind it is.

Also, with sole proprietorships, it may be hard to manage liabilities, as the owner is <em>personally</em><em> </em>responsible for any liabilities. It is also hard to procure funding for your company.

However, it is simple to incorporate and allows for high flexibility, which may be what you mean by "easiest type ... to start".

8 0
3 years ago
Can anyone help me please?
Lana71 [14]

Answer:

I think the answer is 2 or 1

Explanation:

(so sorry if im wrong)

5 0
3 years ago
Convection currents are powered by:
Elena L [17]
The answer is a. heat
6 0
3 years ago
Biology vocab pls help
KonstantinChe [14]
1. Healthy
2. Space
3. Recourses
4. Lower
5. Food supply
6. Increase
7. Emigration
7 0
3 years ago
Which of the following best describes reproductive structures common to both gymnosperms and angiosperms?
JulijaS [17]
"Seeds formed after combining pollen and egg cells during sexual reproduction" is the one among the following that <span>best describes reproductive structures common to both gymnosperms and angiosperms. The correct option among all the options that are given in the question is the first option or option "A". </span>
6 0
3 years ago
Other questions:
  • What is a autotroph?
    11·2 answers
  • 1. How does a basic stain work? <br> microbiology
    7·2 answers
  • How do the geosphere and atmosphere interact in the carbon cycle
    9·1 answer
  • A researcher examining a root tip observes a plant cell with condensed sister chromatids, kinetochores with attached microtubule
    15·1 answer
  • DNA is typically found in cells in the form of a very long strand that is coiled many times and contains thousands or millions o
    7·2 answers
  • What is the meaning of atomic models
    13·1 answer
  • A biodegradable substance is
    5·2 answers
  • How long does an average blue whale live? idrk
    8·2 answers
  • 5. The graphs below shows the rate of water conduction up three different trees in a forest over 24 hours. 2.5- tree A 2.0 rate
    14·1 answer
  • People continually waste, deplete, and degrade much of Earth's natural capital—a process known as point source pollution natural
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!