1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
2 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]2 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
In any population there will be variations of certain characteristics. For example, in the giraffe population there is a variati
sdas [7]
Hi there!

The best possible scenario for the giraffes with longer necks to survive would be one in which all the lower leaves somehow disappear! This would mean only giraffes with longer necks can eat therefore those will have a better chance of surviving. Luckily the answer that fits that perfectly would be...

D. Monkeys swarm in and tear off all of the lower leaves to use for shelters.
8 0
3 years ago
Read 2 more answers
Which animals are the oldest vertebrate fossils?
bezimeni [28]

Answer: Armored fish

Explanation:

The earliest known fossil vertebrates were heavily armored fish discovered fish in rocks from the Ordovician period.

The fossils shows the path from the early aquatic life to the vertebrates, vertebrates to mammals.

The fossils shows that it is vertebrate and are the oldest known fossil ever known. The fossils of the animals and plants helps to known the behavior of the past time and based on that research and study is done.

8 0
3 years ago
With rare exceptions, which of the following characteristics do plants share?
bulgar [2K]
C. Because most plants have prokaryotes
6 0
2 years ago
When magma is trapped and cooled underground, it is called
dem82 [27]

Answer:

intrusive igneous

Explanation:

8 0
2 years ago
Read 2 more answers
The organization of the termite colony is an example of which benefit of social behavior?
PSYCHO15rus [73]

Answer:protection

Explanation:

I’m taking a ✨ guess ✨

7 0
2 years ago
Read 2 more answers
Other questions:
  • Which is not a negative effect on the earth system resulting from the construction of a dam?
    13·2 answers
  • What must occur for a process to be a chemical reaction?
    8·1 answer
  • Forests help to regulate the global climate by
    15·1 answer
  • Gisela is suffering from a condition that involves thickening of the lenses of her eyes. This causes her vision to become cloudy
    11·1 answer
  • Describe A Neritic Biome.
    5·1 answer
  • After applying the selection process, your bacterial cells may contain at least three different types of common possible recombi
    14·1 answer
  • The fetal hold should never be used on
    15·1 answer
  • According to cell theory, which of the following would be composed of cells?
    7·1 answer
  • What is not a characteristic of a pioneer species
    5·2 answers
  • What type of energy is being transferred during predation ?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!