1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]3 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
Explain intelligence.
Naily [24]

B. The ability to respond to the environment good decision

5 0
3 years ago
What causes the formation of graded beds of sediment?​
Mamont248 [21]

In geology, a graded bed is one characterized by a systematic change in grain or clast size from one side of the bed to the other. Most commonly this takes the form of normal grading, with coarser sediments at the base, which grade upward into progressively finer onesI just learned about this in our rocks and minerals unit for science,

8 0
3 years ago
Create a food web by typing the name of 6 organisms. Be sure to label each organism. (Consumer, producer, decomposers, primary c
dolphi86 [110]
Hope it helps ksksksksksksksks

5 0
3 years ago
Which enzyme unzips or unwinds the two dna strands away from each other?
alexandr1967 [171]

Answer:

Helicase

Explanation:

5 0
3 years ago
Most sperm cells die in the vagina when entering the female's body because Most sperm cells die in the vagina when entering the
taurus [48]

Answer:

of the low pH of the vagina.

Explanation:

The pH of the vagina is maintained at highly acidic levels to prevent the germ buildup. The range of vaginal pH is around 3.8 to 4.5. The very low pH of the vagina creates a hostile environment for sperms and most of the sperms are killed as they enter the vagina due to the acidic pH.

Apart from supplementing the sperms with energy, cervical mucus serves to protect the sperms from the hostile conditions of the vagina. The cervical mucus has an alkaline pH at or near the ovulation to protect sperms from acidic pH of the vagina and to facilitate fertilization.

6 0
3 years ago
Other questions:
  • ​fertility usually resumes within _____ after contraceptive use stops.
    10·1 answer
  • Since his cerebral vascular accident, mr. harold thomas has been unable to recognize and identify objects by touch because of in
    11·1 answer
  • A certain type of specialized cell contains an unusually large amount of rough endoplasmic reticulum (ER).
    5·1 answer
  • Identify the placement of items A-F using the drop-
    9·2 answers
  • What type of pathogens do antibiotics fight against
    6·1 answer
  • Which planet do most known extrasolar planets most resemble?
    8·1 answer
  • Helppppppppppppppppppppppppp!!!!?!?!?!?!!!
    11·1 answer
  • Among dogs, short hair is dominant to long hair and dark coat color is dominant to white (albino) coat color. Assume that these
    10·1 answer
  • For how long heart stops when you sneeze
    10·2 answers
  • The Truth About Milk Essay! Please read! Rate this from a scale of 1 - 10 and please share! Link leads to petition
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!