1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
2 years ago
7

8 What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A.

Biology
1 answer:
Mila [183]2 years ago
6 0

Answer:

T-A-A-C-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

You might be interested in
Which of the following statements is most clearly inductively derived? (eText Concept 1.3)
Svetlanka [38]

Answer:

The correct answer is option - A.

Explanation:

The inductive reasoning is an approach or method that is based on the supplying evidence for proving the conclusion as true. Or in their words, inductive reasoning is an approach in which specific statements to a generalized conclusion.

The statement of option "a" provides a piece of evidence and on the base of evidence derived a conclusion.

Thus, the correct answer is option - A.

5 0
3 years ago
the nutrients in foods perform functions in the body, what are they and briefly describe the nutrients involved in these functio
Ludmilka [50]

Answer:

The human body needs a list of macromolecules and micromolecules for performing day to day functions.

The essential macronutrients that the body requires are:

Carbohydrates: Carbohydrates are required by the cells in the body to carry out normal day to day functions. Energy is provided in the form of calories by the carbohydrates.

Proteins: Proteins are essential nutrients which are required for growth as well as better functioning of the immune cells of the body.

Fats and oils: These are needed for providing insulation to the body and to store energy.

Fibres: These are a mixture of carbohydrates.

Water: Almost every activity of the body requires water.

The essential micronutrients that the body requires are:

Vitamins: Vitamins are a group of substances which are needed by the body to function normally.

Minerals: Mineral are needed to ensure that tissues are working correctly.

7 0
3 years ago
24 pts!
Ne4ueva [31]
The answer is B

Explanation: RNA is single stranded and contain uracil
6 0
3 years ago
Read 2 more answers
There is a population of beetles that typically have black wings. A scientist studying these beetles knows that their eggs hatch
ioda

Answer:

A) Black winged beetles have higher fitness than white winged beetles

Explanation:

Because after the white winged beetles have played their eggs they die

7 0
3 years ago
What is the composition of the most common mineral compounds that make up the Earth's crust and mantle?
babunello [35]
Oxygen and silicon make up most of earths crust 
5 0
3 years ago
Other questions:
  • Proteins are called the building blocks. Theyre needed for growth and development and to repair the normal wear and tear of the
    11·1 answer
  • I NEED HELP ASAP!!!
    9·1 answer
  • The red lionfish, Pterois volitans, has beautiful red stripes, streaming fins, and a fearless disposition, and it is deadly. Nat
    15·1 answer
  • Which type of rock forms when molten material cools and hardens inside Earth? an igneous rock an extrusive rock a rock with fine
    8·2 answers
  • Which one answer is not a way to build a sustainable food system?
    15·1 answer
  • How does energy change as it moves through the ecosystem?
    11·2 answers
  • What is the overall purpose of photosynthesis
    13·1 answer
  • State the effect of weather on humans activity​
    5·1 answer
  • If you traveled 90 km in 0.50 hours, what <br><br> was your average speed
    11·1 answer
  • What makes a plant a producer?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!