1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
3 years ago
8

What best explains why there's fewer secondary consumers than producers?

Biology
1 answer:
monitta3 years ago
8 0

Answer:

because of inefficiency

Explanation:

The organisms that eat the primary consumers are meat eaters (carnivores) and are called the secondary consumers. ... Because of this inefficiency, there is only enough food for a few top level consumers, but there is lots of food for herbivores lower down on the food chain. There are fewer consumers than producers.

You might be interested in
Gypsum and quartz can look very similar. which test can help you distinguish them?
katen-ka-za [31]

The test that they can use in differentiating the gypsum and quartz which are considered to be minerals is the mineral test. The mineral test can differentiate the hardiness of the minerals, as well as their; acidity, magnetism, streak, specific gravity and even their tenacity.

6 0
3 years ago
Which action describes an experimental investigation?
liberstina [14]

The statement 'Exploring the relationship between the material in a rock sample and its hardness' correctly describes an experimental investigation (Option C).

<h3>What is an experimental investigation?</h3>

An experimental investigation is defined as a procedure used in the scientific method to test an explanation or hypothesis, which can be confirmed or rejected.

In conclusion, the statement 'Exploring the relationship between the material in a rock sample and its hardness' correctly describes an experimental investigation (Option C).

Learn more about experimental investigations here:

brainly.com/question/2115801

#SPJ1

7 0
2 years ago
PLEASE HELP FOR BRAINLIEST! :)
lbvjy [14]

Answer:

The system of measurement that is used through out the world is know as <u>International System of Units or, in French, Système International (SI).</u>

<u />

Explanation:

In order to describe motion, scientists use SI units to describe the distance an object moves.

<u>In system international (SI) or metric units, motion involves the units meters and seconds. </u>

Due to the  consistency of units used  the information described by one individual in a country is easily  understandable by someone else in a different country .  

For example: if someone describe the speed of an object to be 30 meters per second, anyone using the same units can understand this. whereas , the use of units such as foot per second is understandable to only  small number of countries

5 0
3 years ago
WILL GIVE BRIANIEST TO BEST/CORRECT ANSWER!!​
Len [333]

Answer:

The correct answer is plants have two parts life cycle spending one part of their life in diploid phase and the other part in the haploid phase,human spending their lives in diploid phase and produces gamets that are haploid.

Explanation:

There are two stages in the life cycle of plant one is gametophyte stage which is haploid and the other is sporophyte stage that is diploid.

    but in case of humans the overall life cycle proceed in diploid phase and produces gamets that are haploid.

    In case of human male produces haploid gamet known as sperm and the female produces haploid gamet know as ovum. The sperm and ovum fuses to form diploid zygote,

4 0
3 years ago
How are chromosomes analyzed within a karyotype
Brrunno [24]
The number and appearance of chromosomes in a cell is called a karyotype. A karyotype can only be seen and studied with a microscope. ... Karyotype analysis can reveal abnormalities, such as missing chromosomes, extra chromosomes, deletions, duplications, and translocations.

Link:https://study.com/academy/lesson/karyotype-definition-disorders-analysis.html

Note: This information has been taken out of a website.
4 0
3 years ago
Other questions:
  • Where is ATP synthase located in the mitochondrion?
    14·1 answer
  • Which of the following may occur at a transform plate boundary?
    12·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of these can be classified as a pure substance?
    8·2 answers
  • Which of the following statements about vegetable oils that have been hydrogenated is TRUE?
    9·1 answer
  • DNA polymerase has multiple mechanisms for editing and error correction, whereas the capacity for error correction in RNA polyme
    10·1 answer
  • what is the best synonym for hormone A. Bodily organ B. bodily tissue C. Blood cell D. Chemical Messenger
    5·2 answers
  • Why is dna referred to as your genetic fingerprint??
    8·1 answer
  • Which process is used by the skin to repair itself when you get cut claim, evidence, reasoning
    7·1 answer
  • A population of wolves is reintroduced into Yellowstone National Park. For the first decade, the wolf population grows exponenti
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!