1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mars2501 [29]
3 years ago
6

A population of mice in a meadow is growing in a pattern of logistic growth. Arrange these events in the order in which they occ

ur.
1. The population fluctuates near carrying capacity
2. The population increase begins to slow
3. The population increases exponentially
Biology
1 answer:
Ray Of Light [21]3 years ago
6 0

Answer:

2, 3, 1

Explanation:

For logistic population growth, the initial growth is slow while the population is trying to get acclimatized to the environment but the growth increases exponentially once it is done acclimatizing. The exponential growth continues until the carrying capacity is reached and then starts to fluctuate around the carrying capacity.<u> The carrying capacity signifies the maximum size of the population that the environment can support based on the resources that it has.</u> Hence, the logistic population growth curve forms a S shape.

In summary, the correct order of events is:

  • <em>The population increase begins to slow</em>
  • <em>The population increases exponentially</em>
  • <em> The population fluctuates near carrying capacity</em>

Therefore, the order is 2, 3, 1.

You might be interested in
Staphylococcus aureus, or staph, is a bacteria that is commonly found in the nose and on the skin of humans. While it is typical
Liono4ka [1.6K]
A. complement system
6 0
3 years ago
Read 2 more answers
Organisms are named and classified based on physical characteristics in
Aleks [24]

Answer:

Linnaeus taxonomy

Explanation:

organisms are named and classified based on physical characteristics in linnaean taxonomy Which of the following is the most abundant group of organisms on Earth.

5 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The mating of an Aa male and an aa female produced an offspring with the genotype AAa. Therefore, the offspring has 3 copies of
blondinia [14]

Answer:

<em>Ana-phase 1 of Meiosis 1 in Male Parent...</em>

Explanation:

It is clear that meiosis is only happening in male due to AAa nondisjuction of dominant AA from male parent. The disjunction is occuring during spermato-genesis during Ana-phase 1 of Meiosis 1 cause it is only possible explanation of tri-somy at Chromosome 1...

5 0
3 years ago
Please help meeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Mrrafil [7]

Answer:

number 1 answer is 3.

number 2 energy is flowing upwards. ex grasshopper eats the grass, rat or whatever that is eats the grasshopper, and the hawk eats the rat. energy is going up each trophic level.

number 3. if the grass became polluted, then animals would get pollution in their bodies and at some point would die. eventually the grass would die too. primary consumers such as mouse, rabbit, grasshopper/snails would accumulate the most pollution because they directly eat the grass. whatever that is in the grass goes straight into their bodies.

6 0
3 years ago
Other questions:
  • How does Earths atmosphere keeps daytime temperatures cooler and nighttime temperatures warmer as compared to the moon?
    11·1 answer
  • Which of the following represents the smallest unit of life
    9·2 answers
  • 8) What four elements make up 96% of the human body's mass?
    7·1 answer
  • Why is bicarbonate is mixed with water in the leaf disc experiment?
    11·1 answer
  • HELP! HELP! HELP!<br><br> LooK at Pic!<br><br> plz help
    11·1 answer
  • Thus is the question I'm NOT Sure of the awnser any help?
    13·2 answers
  • Which is not classified as a living thing?
    15·2 answers
  • Internal membrane system that helps make proteins ...
    5·1 answer
  • Explain briefly the 3 stages of theory development​
    15·1 answer
  • (03.05 hc) the base pairs in a dna strand are held together with hydrogen bonds. if the two nitrogenous bases in each pair were
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!