1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kodGreya [7K]
3 years ago
15

Heat is added to an element causing the atoms to bounce back and forth in the molecule. This is an example of which type of moti

on?
Question 2 options:

a.Rotational motion

b.Vibrational motion

c.Translational motion

d.Inertia
Biology
1 answer:
777dan777 [17]3 years ago
8 0

Answer:

B

Explanation:

When atoms bombard each other, they move vigorously hence they vibrate quickly

You might be interested in
1.Do you like to eat new and different foods? Which of the foods mentioned sound interesting or appetizing to you? Why? If you h
Ymorist [56]
I luv to eat new and different foods!! My family is a whole mix of different cultures, so we always get to try new, unusual foods. Some of my favorite are sushi, flax seed tortilla chips and tamales. Guess what? I've even eaten surstomming, or rotten fish!!!! Yuck, am I right? I think its fun and exciting to eat new things. These are my top 3 spanish foods.
1. tamales
2. fajitas
3. burritos
Hope this helps!!!!!!!!! (:
6 0
4 years ago
Why is soil erosion important to agriculture?
Alexxx [7]

Answer:

Soil erosion causes siltation in rivers, dams, etc. In some areas, huge river deltas are formed (such as River Nile delta) because of soil erosion. Such places are good for agriculture but not good for urbanization. However, some people do not care about it, they just want to construct buildings on alluvium type soils.

4 0
4 years ago
Read 2 more answers
Rebekka notices a huge crack in a large boulder in her garden she realizes the crack was caused by Frost wedging place the steps
Elenna [48]

The correct order is:

B. Rain water is stored in rock and seeps into a hairline crack during a rainfall;

E. The temperature falls below 0° Celsius;

D. Rainwater in the rock crack freezes into ice;

C. Because ice occupies more space than water, the ice wedges the crack open:

A. The freeze-thaw cycle continues to deepen the crack until the rock splits into 2 pieces;

The water from the rain gradually manages to weather parts of the rock. As it does, small cracks appear in it. Once there's cracks, the water from the rainfall also starts to store inside the rock. When the colder period of the year comes, and the temperatures fall bellow 0°C, the stored water freezes. The ice starts to spread inside the crack, thus creating pressure inside the rock. As the pressure is becoming bigger and bigger, the rock will eventually crack into two or more pieces.

4 0
3 years ago
Read 2 more answers
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
The bunnies in a forest have different colored fur at different times of the year. The bunnies you see have brown fur in the fal
Leokris [45]

Answer: A) Evolution or B) Natural Selection

Explanation: The fur of these bunnies change color with the seasons in order to better blend into their environment. This is an example of a species evolving to better survive!

However, this could also happen as a result of natural selection. Those who were able to better survive would pass on their genes for fur that changes with the seasons.

7 0
3 years ago
Other questions:
  • How do scientists measure the amount of dissolved substances in water?
    10·1 answer
  • The five basic stages of sleep are further classified into two distinct orders characterized by
    12·1 answer
  • Edema occurs when blood pressure exceeds the counteracting force of ______ in the bloodstream, so fluid remains in the spaces su
    9·2 answers
  • I will give brainly to first one to answer
    14·1 answer
  • How would animal’s waste affect the plants that grow in that area
    7·2 answers
  • Is foliation a characteristic of a sedimentary rock?
    8·1 answer
  • If garbage is left on the street flies in microbes can arise from nothing to Feed on it true or false
    8·2 answers
  • Punnet squares, 75 points
    5·1 answer
  • What 3 types of science formed the geological time scale?
    12·1 answer
  • Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!