1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
3 years ago
10

What is endosperm? via cotyledons, a source of food for the embryo the leaves that are a part of the embryo the male portion of

a flowering plant the female portion of a flowering plant tissue that develops into a protective seed coat surrounding the embryo
Biology
1 answer:
AfilCa [17]3 years ago
4 0

Answer: Option A

Explanation:

An endosperm is defined as the tissue which are produced inside the seeds during fertilization. As the endosperm surrounds the embryo, it acts as the food storage for the embryo and provide nutrition.

During embryo development , endosperms supports enlargement of cotyledons which helps in storage function and stores fats and starch and provide nourishment to the embryo.

for example cereal crops or grains are primarily endosperm which stores fat and starch and are edible fruits.

Hence, the correct option is A, endosperm can be a cotyledon which functions as a source of food for embryo.

You might be interested in
Explain the difference between the offspring of sexual
Debora [2.8K]

Answer:

asexual reproduction is produced without intercorse while sexual reproducttion is with intercorse

Explanation:

7 0
2 years ago
Read 2 more answers
(BRAINLIEST QUESTION) Natural selection is an important part of evolution. It is:
ladessa [460]

Answer:

The answer to the first one is B. A mechanism for the evolution of a population to become better adapted to their environment over many generations.

The answer for the second one is C.vestigial

Explanation:

8 0
3 years ago
2. Cellular respiration does not produce<br> O ATP<br> carbon dioxide<br> O glucose<br> O water
pochemuha
The answer is glucose.
3 0
3 years ago
ASAP PLEASE I NEED THIS WITHIN 25 Minutes!!! Carefully review the image. Based on this food web, fill in a trophic-level ecologi
loris [4]

Answer:

Its been past 25 min

Explanation:

sorry I couldn't get to it fast enough

7 0
2 years ago
Read 2 more answers
Which statement about vacuoles is true?
VARVARA [1.3K]

Vacuoles are storage organelles that are found in both animal and plant cells. They store food or any other forms of nutrients, they also store waste products so as to protect the contamination of the cell environment. These waste products are sent out of the cell via vacuoles. In plants the vacuoles are larger than in animals. The vacuole provides plant nourishment in the scarcity of water in the external environment hence, prevents the wilting of plants.

7 0
3 years ago
Other questions:
  • Like animals, plants undergo cellular respiration to produce energy. Plants use oxygen and release carbon dioxide and water. Wat
    6·2 answers
  • Sleepwalking is most likely to be associated with ________ sleep. nrem-1 sleep rem alpha sleep nrem-3 nrem-2 sleep
    12·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What are the "twisty columns" and "rungs" in the DNA?
    13·2 answers
  • What makes DNA evidence unique? Be specific.
    15·2 answers
  • 3. Which is true about the light-independent reactions?
    7·1 answer
  • If the nucleotides 5'-GAT-3' are paired with the nucleotides 3'-CUA-5', the pairing must be __________.
    11·1 answer
  • Which of the following would most likely be the major focus of a biologist?
    12·2 answers
  • Where would you find DNA in plant and animal cells?
    11·2 answers
  • which of these is the best imaging technique for routinely examine the anatomical development of a fetus
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!