1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lina20 [59]
3 years ago
7

In order to get a single solution to a linear system having two variables

Biology
1 answer:
Alenkinab [10]3 years ago
5 0
It’s E,two independent linear equations,each having at least one of the variables
You might be interested in
Why is good habitat important for animals?
Setler [38]
Because if animals dint have a good habitat they wont have a desent place to bd in
6 0
3 years ago
A student preparing for a hike wants to pack a snack that has biomolecules that provide quickly available Energy but few excess
Valentin [98]

Answer:d

Explanation:

3 0
3 years ago
The term for the distance over which wind blows uninterrupted is called ____.
lukranit [14]
Fetch
(sry have to make an answer 20 characters /!:!27837)
6 0
3 years ago
Read 2 more answers
2. Which of the following is a sample of igneous rock?
miskamm [114]

Answer: The actual answer is sample B.

Explanation: Igneous Rocks are either known as Intrusive Rocks which are crystallize that form underneath the Earth's Surface, and Extrusive Rocks which are known as volcanic rocks.

5 0
3 years ago
Can someone tell me what the function is pls i’ll give brainiest
Digiron [165]
A lysosome is a membrane-bound cell organelle that contains digestive enzymes. Lysosomes are involved with various cell processes. They break down excess or worn-out cell parts. They may be used to destroy invading viruses and bacteria, A vacuole is a membrane-bound cell organelle. In animal cells, vacuoles are generally small and help sequester waste products. In plant cells, vacuoles help maintain water balance.
4 0
3 years ago
Read 2 more answers
Other questions:
  • The ____________ is the first vessel blood enters upon exiting the heart.
    14·1 answer
  • Which has prokaryotic cells
    14·2 answers
  • How do products of meiosis I differ from those of meiosis ll?
    14·1 answer
  • This occurs to bodies of rock when one body of rock moves relative to another. qizlet
    15·2 answers
  • How is meiosis different from mitosis.
    15·1 answer
  • The products of cellular respiration are the reactants of photosynthesis.<br> TRUE<br> FALSE
    9·1 answer
  • A scientist wanted to investigate whether light is required for the germination
    13·1 answer
  • Write a letter to the government explaining the dangers posed by global warming/climate change​
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which statement summarizes the changes that occur to energy in cellular respiration
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!