Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
1.Using fossils as a base
2.Creation of the tissues and muscles out of clay.
Explanation:
The fossils available are used as a base for the reconstruction of the face. Without the well preserved and near complete skull there is no possibility. There must be a good level of preservation of fossils in order to reconstruct the fossils.
The sticks are first placed to approximate the depth of tissues over the bone. The tissues and muscles are molded out of the clay.
Finally the detailed painting creates the skin color, texture and expressions of the facial reconstruction.
<u>Answer:</u>
<em>The following statement describes the period of mitosis.</em>
<u>Explanation:</u>
In this process the contents of cell are copied ad then the cell’s split up. The pair which are formed are identical in nature. In this <em>transformation the cells contain single chromosome each. </em>
The process here also represents to let the process go on continuously. There are 7 various stages of mitosis which is studied. <em>Mainly the process of mitosis is diving and emerging into more cells.</em>