1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darina [25.2K]
3 years ago
12

An infant is born in the breech position, and assessment indicates the presence of erb palsy (erb-duchenne paralysis). which cli

nical manifestation supports this conclusion?
Biology
1 answer:
Marina86 [1]3 years ago
6 0
The clinical manifestation which supports this conclusion is that an injury to the brachial plexus which happens during birth. Erb is termed as a paralysis of the arm which is caused by an injury on upper arm's main nerves to be specifically the C5-C6 nerves.
It arrives most commonly on shoulder dystocia when there is a difficult birth. This paralysis can resolve on its own depending on nature of the damage.
You might be interested in
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
viruses and bacteria are both microscopic and can both cause disease virus differ from bacteria in that all virsuses
tiny-mole [99]
Viruses cannot live on their own.
7 0
3 years ago
The carp fish has 104 chromosomes in its body cells. When the fish's body cells divide by mitosis, how many chromosomes will eac
cupoosta [38]

The answer is C. 104

8 0
3 years ago
Facial reconstruction is the process by which an artist reconstructs a face from skeletal remains. When the first evidence of a
irakobra [83]

Answer:  

1.Using fossils as a base

2.Creation of the tissues and muscles out of clay.

Explanation:

The fossils available are used as a base for the reconstruction of the face. Without the well preserved and near complete skull there is no possibility. There must be a good level of preservation of fossils in order to reconstruct the fossils.

The sticks are first placed to approximate the depth of tissues over the bone. The tissues and muscles are molded out of the clay.

Finally the detailed painting creates the skin color, texture and expressions of the facial reconstruction.

7 0
3 years ago
This is the end result of mitosis. One mother cell produces two exact copies or daughter cells.
anzhelika [568]

<u>Answer:</u>

<em>The following statement describes the period of mitosis.</em>

<u>Explanation:</u>

In this process the contents of cell are copied ad then the cell’s split up. The pair which are formed are identical in nature. In this <em>transformation the cells contain single chromosome each. </em>

The process here also represents to let the process go on continuously. There are 7 various stages of mitosis which is studied. <em>Mainly the process of mitosis is diving and emerging into more cells.</em>

6 0
3 years ago
Other questions:
  • Sponges are comprised of several cell types, which are similar to those found in the eumetazoa, but also display a unique degree
    13·2 answers
  • Which of the following body systems breaks down proteins into amino acids
    8·1 answer
  • Why would a lack of neurotransmitters change the function of the brain?
    11·2 answers
  • Herbivores, carnivores, and omnivores are subclasses of which one of the four components of a typical ecosystem?
    7·1 answer
  • Which best describes an amino acid?
    12·1 answer
  • Write the slope intercept equation for the line with a slope of -3 that goes through the point (-2,1)
    13·1 answer
  • Please answer tysm!!!
    11·2 answers
  • There are 3 basic structural types of joints: fibrous, cartilaginous, and synovial. If a joint does NOT move, you can assume tha
    12·1 answer
  • How are photosynthesis and cellular respiration chemically opposite.
    6·1 answer
  • Help me please that will mean a lot to me if y’all help me
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!