1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
3 years ago
15

At which location would an object’s weight be the greatest

Biology
2 answers:
densk [106]3 years ago
6 0
The answer is the earth
miss Akunina [59]3 years ago
5 0
I would think the earth because it has the most gravitational pull
You might be interested in
HELP ASSAAAPPPP PLEASE
givi [52]

Answer:

fire

Explanation:

because dessert climate can consist of fire

6 0
3 years ago
Read 2 more answers
What effects would El Niño most likely have on organisms?
solniwko [45]
The answer is C. El Niño would cause changes in the genetic makeup of organisms.
8 0
3 years ago
The rhomboideus minor muscle originates on which process on the vertebrae? Select to launch animation The rhomboideus minor musc
siniylev [52]

Answer:

Spinous process

Explanation:

The rhomboideus minor muscle originates on the <u>spinous processes</u> of vertebrae T2-T5

The rhomboideus minor muscle forms part of the superficial group of back muscles. The muscles in the superficial group are immediately deep to the skin and superficial fascia. They attach the superior part of the appendicular skeleton (clavicle, scapula, and humerus) to the axial skeleton (skull, ribs, and vertebral column).

These muscles are sometimes referred to as the appendicular group, since they are primarily involved with movements of part of the appendicular skeleton.

The rhomboideus minor is located deep to the trapezius in the superior part of the back. It inserts on the medial border of the scapula, is innervated by the dorsal scapular nerve its function is to adduct and elevate the scapula.

4 0
3 years ago
What percent of the trees cut down are used for something other than paper?
ELEN [110]
Thirty-five percent of the trees cut down are used to make paper. That means sixty-five percent of the trees cut down are used for something other than paper. Thank you for posting your question. I hope this answer helped you. Let me know if you need more help. 
7 0
3 years ago
Read 2 more answers
The table shows the relative size of the genomes (total DNA in the nucleus), number of genes, and number of chromosomes for a va
9966 [12]
You don't show the table...but you should see that the more complex an organism, the more chromosomes and the more genes it has.

A bacteria has a small genome. perhaps it has about 5000 genes. it also has 1 chromosome.

Yeast are more complicated than bacteria. Saccharomyces cerevisiae (the yeast that makes beer, wine and bread, has about 6300 genes and 16 chromosomes.

A human has 46 chromosomes (23 pairs), and has likely around 20,000 genes.
6 0
3 years ago
Read 2 more answers
Other questions:
  • A researcher claims that different metabolic pathways allow bacteria to use different molecules as sources of matter and energy.
    6·2 answers
  • { Please Answer Quickly! 50 Points! }
    9·1 answer
  • What results from the removal of a phosphate group from ATP?
    5·1 answer
  • The respiratory system is made up of the airways, lungs, and respiratory muscles. The lungs are classified as –
    14·2 answers
  • What is needed for an idea to be scientifically reliable?
    5·1 answer
  • Part A What is a telomere? What is a telomere? the mechanism that holds two sister chromatids together the ends of linear chromo
    5·1 answer
  • You purchase two identical houseplants and place them side by side on your windowsill. You water both plants equally. One plant,
    9·1 answer
  • Leachate is a harmless solution that can be pumped out of a landfill.<br> True or False
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Will give brainlist​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!