1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
7

7) Wind always moves in which direction? *

Biology
1 answer:
s344n2d4d5 [400]3 years ago
3 0

Answer:

areas of high pressure to areas of low pressure

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Which steroid hormone(s) would not be produced if you blocked the activity of p450scc?
natka813 [3]
P450scc or cholesterol side chain cleavage enzyme is an enzyme that converts cholesterol into pregnenolone (the precursor for steroids). The kinds of steroid hormones are mineralocorticoids (i.e. aldosterone) glucocorticoids (i.e. cortisol), and sex steroids (i.e. testosterone, estrogen). In the event where P450scc is blocked, then there will be no production of mineralocorticoids, glucocorticoids, and sex steroids. There will be no production of aldosterone, cortisol, estradiol, testosterone, and progesterone. This disease is called Lipoid Congenital Adrenal Hyperplasia.
3 0
3 years ago
Which safety rule is MOST important when smelling the product of a chemical reaction?
nekit [7.7K]
Use a wafting motion 

8 0
3 years ago
2. Explain what has to happen to join two monosaccharide units into a disaccharide.
uranmaximum [27]
A disaccharide is formed by two monosaccharides through a condensation reaction. The Hydrogen of one of monosaccharide pairs with the hydroxide (OH) of another monosaccharide. Whe this happens H2O is formed The water molecule is then removed leaving the functional groups of the two monosaccharides able to bond with each other.
6 0
3 years ago
Help asap Which of the following is a decomposer?
Arada [10]
Fungus is a decomposer
4 0
3 years ago
Read 2 more answers
Other questions:
  • When a plant opens and closes its stomata, it is maintaining _____. sugar chemical transmitters homeostasis tropism
    13·2 answers
  • Please help!!!
    10·1 answer
  • The differences seen in the beaks of the species of finches are most likely the result of
    11·1 answer
  • What is an organism that relies on other organisms for its food and energy supply; also called a heterotroph?
    5·1 answer
  • I’m your own words, explain the process of translating mRNA into polypeptide sequences.
    11·1 answer
  • During dna replication which chemical bonds break apart
    8·1 answer
  • What do you mean by derived unit ? Give example?​
    14·1 answer
  • Why does acid rain adamage mountain lebrty
    7·2 answers
  • Flu vaccine reccomandations
    14·1 answer
  • Crossing-over occurs in prophase of mitosis and meiosis.<br> True<br> False
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!