1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solniwko [45]
2 years ago
13

Why are mitochondria considered the power house of animals cells?

Biology
1 answer:
lesya692 [45]2 years ago
4 0
C. They produce ATP
The energy required for various chemical activities needed for life is released by the mitochondria in the form of ATP.
You might be interested in
Vegetable oil is different from animal fat in that the phospholipids in vegetable oil have fatty acid tails that:
kotegsom [21]
Vegetable oil is........................the phospholipids in vegetable oil have fatty acid tails that ARE BEND.
Vegetable oil are made up of unsaturated fatty acids, which means that double bonds are present in the oil. The degree of unsaturation varies depending on the type of oil. The configuration for double bond is cis; this makes the phospholipid in the vegetable oil to have bent structure.
8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Venus is an average distance of 108.2 million kilometers from the Sun. Use the conversion factor 1 AU = 1.5 × 108 km to convert
Igoryamba

Answer:

1 au=1.5 x 108=162

Explanation:

1 AU is equal to 1.5 which means it is the same thing so 1.5x1.08 which =162

5 0
2 years ago
"A snail is an organism". Based on this I would expect that a snail to
kow [346]

Answer:

it's D. has cells

Explanation:

an organism is made of many different cells. what makes something not an organism is how it has no cells, and how it that can't carry out all of the basic physiological functions of a living thing. Organisms grow, adapt, respond to stimuli, and reproduce.

8 0
2 years ago
Modify the existing vector's contents, by erasing the element at index 1 (initially 200), then inserting 100 and 102 in the show
Aleonysh [2.5K]

Answer:

Following are the code to this question:

#include <iostream>//defining header file

#include <vector>//defining header file

using namespace std;

void PrintVectors(vector<int> numsList)//defining a method PrintVectors that accept an array

{

   int j;//defining integer variable

   for (j = 0; j < numsList.size(); ++j)//defining for loop for print array value  

   {

       cout << numsList.at(j) << " ";//print array

   }

   cout << endl;

}

int main()//defining main method  

{

   vector<int> numsList;//defining array numsList

   numsList.push_back(101);//use push_back method to insert value in array

   numsList.push_back(200);//use push_back method to insert value in array

   numsList.push_back(103);//use push_back method to insert value in array

   numsList.erase(numsList.begin()+1);//use erase method to remove value from array

   numsList.insert(numsList.begin(), 100);//use insert method to add value in array

   numsList.insert(numsList.begin()+2, 102);//use insert method to add value in array

   PrintVectors(numsList);//use PrintVectors method print array value

   return 0;

}

Output:

100 101 102 103  

Explanation:

In the above-given code, inside the main method an integer array "numList" is defined, that use insert method to insert value and use the erase method to remove value from the array and at the last "PrintVectors" method is called that accepts a "numList" in its parameter. In the "PrintVectors" method, a for loop is declared, that prints the array values.

7 0
3 years ago
Other questions:
  • Which best represents the role of the cell cycle in repair of an organism? an active cell cycle from a puncture wound an active
    10·2 answers
  • What does the nurse teach a patient with polycystic kidney disease about managing the disease?
    6·1 answer
  • What happens to matter in a biogeochemical cycle
    5·1 answer
  • How do these white blood cells help protect the body
    14·2 answers
  • The _____ works with the Environmental Protection Agency to enforce marine biology regulations along the coast and in the Great
    5·2 answers
  • Which scientific method are not displayed on a graph
    11·1 answer
  • How to plants obtain more sunlight
    7·2 answers
  • Which organelle is the location for photosynthesis
    15·1 answer
  • Which sentence best explains how enzymes speed up a chemical reaction?
    15·2 answers
  • What is true for all cells
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!