1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olasank [31]
2 years ago
5

A student helps his teacher lift a 200 N box of books 1.2 m from the floor to the desktop. In which of the following situations

will he do more work? (DOK 3, AKS
8d)
Ο Α.
He lifts a 175 N box to the same height
OB.
He lifts a box of the same weight to a height of 1.7 m.
С.
He lifts a box of the same weight to a height of 0.9 m.
D.
He lifts a 98 N box to the same height
Biology
1 answer:
Kamila [148]2 years ago
4 0

Answer:

Since he is lifting more N its A 175N

You might be interested in
The maximum number of wolves that can survive in a particular forest is 230
Kipish [7]
Hey There :)  

This means wolves are slowly getting extinct and they are endangered.
8 0
2 years ago
Why can't you go to a garden store and buy fern seeds?
Delvig [45]

Answer:

A, as in Apple

5 0
3 years ago
Read 2 more answers
What factors can limit the growth of the human population?
tresset_1 [31]
We would over populate the eart leading to no water or no food, we would eventually go into a fallout and have nuculer war and then everything is gonna go to sh and we are going to have to repopulate 
5 0
3 years ago
Unlike in prokaryotic cells, replication in eukaryotic cells
elena-14-01-66 [18.8K]
<span>a. is continuous in two directions until the whole chromosome is copied.

</span><span>The two identical daughter cells resulting from mitosis and cytokinesis are identical in the following ways:1. Mitosis occurs when the nucleus of the cell divides into two identical nuclei, each with the same type and number of chromosomes. The cell's DNA is duplicated during this phase. Sometimes the cell's DNA isn't copied properly resulting in cancer-type cells. 2. Cytokinesis is when the cytoplasm divides into two identical daughter cells. Each cell is genetically identical and both are a similar size. </span>
4 0
3 years ago
The amygdala is the brain region that is most often called into action under situations of
const2013 [10]
<span>The amygdala is most used in times of fear, as well as for olfactory processing such as smell and pheromones, and emotional memory storage. It is located within the temporal lobes of the brain, where it receives sensory input and send signals to various parts of the brain including hypothalamus, the trigeminal nerve, and the ventral tegmental area.</span>
5 0
3 years ago
Other questions:
  • In fruit flies, the allele for white eyes is recessive to the allele for red eyes. In a generation of fruit flies, 45 males with
    5·2 answers
  • Most energy sources are derived from the Sun's energy. True False
    6·2 answers
  • How does the circulatory system work at the organ level?
    14·2 answers
  • A student is constructing a pyramid of numbers. Which units should she use?
    12·2 answers
  • All electromagnetic radiation:
    13·2 answers
  • Which part of Earth is included in the hydrosphere?
    14·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is a principle of the fluid mosaic model of cell membrane structure?
    14·1 answer
  • Describe how a food chain/web supports the processes of cellular respiration and photosynthesis.
    9·1 answer
  • Is used in all steps of protein synthesis and carries the genetic information of many viruses.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!