1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MA_775_DIABLO [31]
3 years ago
15

What are the phenotypes of an organism?

Biology
2 answers:
Vedmedyk [2.9K]3 years ago
4 0

I believe the answer to this is:

B. The organism's physical traits

Hope this helps! :D

Serga [27]3 years ago
3 0

B. the organism's physical traits

hope it is helpful to you ☺️

You might be interested in
1, name the part of the reproductive system in which fertilisation happens.
Nady [450]
I’m going for real I haven’t done this because it was hard didn’t get it but now I know // ANSWER -
4 0
3 years ago
Read 2 more answers
What is a system of ideas that explains many related observations and is supported by a large body of evidence?
lisabon 2012 [21]
I believe this would be called the Golgi Apparatus
6 0
3 years ago
What is the definition for a Cyclone
Novosadov [1.4K]

Answer:

Cyclone: a system of winds rotating inward to an area of low atmospheric pressure, with a counterclockwise (northern hemisphere) or clockwise (southern hemisphere) circulation; a depression.

8 0
3 years ago
Read 2 more answers
The efferent division of the peripheral nervous system innervates ________ cells.
Marina CMI [18]

Answer:

heart muscle , skeletal muscle , glandula and smooth muscle

Explanation:

The peripheral system distinguishes two major divisions: the afferent and the efferent. Afferent division is formed by the nerves that carry information to the central nervous system. In the efferent division the information travels from the central system to the effector organs, both muscular and other (including skeletal muscle, heart, glands, smooth muscle). Within the efferent division, in turn, two systems are distinguished, the somatic and the visceral or autonomous.

The somatic system conducts the signals that give rise to body movements and actions outside the body. It is formed by the fibers of the motor neurons that innervate the skeletal muscles; Their cell bodies are found in the spinal cord and a single axon reaches the muscle fibers it innervates. The action of these motor neurons always consists in the excitation and contraction of the muscles, although muscular activity can be inhibited by inhibitory synapses in charge of central system neurons.

The visceral system is formed by the fibers that innervate the smooth muscles, the heart, the glands and other non-motor organs or tissues, such as brown fat. It controls functions that are mainly related to the maintenance of internal environment conditions and also certain automatic responses to external stimuli. Regulates visceral activities such as circulation, digestion, thermoregulation.

8 0
3 years ago
An older patient is admitted to the hospital with a urinary infection and possible bacterial sepsis. The family is concerned bec
slava [35]

Answer:

D

Explanation:

8 0
4 years ago
Other questions:
  • What is the reactant (substrate) in the reaction above?
    14·1 answer
  • Your uncle has kidney disease and his doctor recommends dialysis. he opts for treatment he can do at home. what did he choose? y
    8·2 answers
  • Several studies have shown an increase in atmospheric carbon dioxide. These increased levels play a direct effect on biogeochemi
    15·2 answers
  • Does a television in the bedroom cause a higher body mass index
    8·1 answer
  • what is the significance of the similar number and arrangement of bones in a human arm and a bat wing ?
    7·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What is the purpose of a pH indicator?
    11·1 answer
  • 3. How is scientific knowledge different from other types of knowledge?
    13·2 answers
  • Individual "A" produces 10 offspring, 8 of whom survive to adulthood. Individual "B" (a member of the same population) produces
    15·2 answers
  • Match the terms in Column I with the descriptions in Column II.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!