1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tigry1 [53]
2 years ago
14

STAAR 11B

Biology
1 answer:
hichkok12 [17]2 years ago
7 0

Answer: J

Explanation:

You might be interested in
Charles
wlad13 [49]
The answer is c. is a 65 year old excutive who is very overwight.
6 0
3 years ago
PLZ HELP! WILL GIVE BRAINLIEST!
vazorg [7]
Help with what? I don’t understand what you need help with ?
7 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What are the four classes of carbon containing molecules used by living things?
Fudgin [204]
Living things contain four major types of carbon-based molecules. The organic molecules in living things fall into four major groups— carbohydrates, lipids, proteins, and nucleic acids. You may already be familiar with these types of molecules and their functions.
6 0
3 years ago
Read 2 more answers
A group of animal behaviorists has discovered several new species of insects in the Amazon jungle. They collect the new species
Mandarinka [93]

Answer:

Peer review

Explanation:

According to my research on different scientific processes, I can say that based on the information provided within the question this shows their commitment to peer review. Peer review is  the evaluation of work by one or more people with similar competences as the producers of the work. Which is what is happening in the situation described in the question. This allows for science to advance faster and for new developments to be discovered.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

3 0
3 years ago
Other questions:
  • Name three resources for which organisms might compete. (0.6 pts)
    5·1 answer
  • How are fish often preserved?
    12·2 answers
  • When a pregnant woman's "water breaks" what is actually happening is
    13·2 answers
  • 1. What is the difference between food chain and food web?
    14·2 answers
  • A measurement that determines how often the allele (gene variant) expression of a particular gene arises in a population and is
    8·1 answer
  • Food chains and webs not only describe the order organisms are eaten, but they also describe the _____.
    10·1 answer
  • An interval in time, such as thr time it takrs for a pedullun to swimg back and forth​
    12·1 answer
  • The picture shows an organ system in the human body
    13·2 answers
  • What factors contribute to different biomes over the globe
    5·1 answer
  • Marine dead zones can form when nutrient run-off causes certain types of algae to grow very quickly and then die off. As dead al
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!