1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
13

Place the events in the transmission of an action potential in the correct order. 1. An action potential begins in the receiving

neuron. 2. Neurotransmitters are released into the synaptic cleft. 3. An action potential arrives at an axon terminal. 4. Calcium ions enter the axon terminal. 5. Sodium ions diffuse into the receiving neuron. 6. Synaptic vesicles fuse with the plasma membrane. 7. Neurotransmitter molecules bind to the membrane of the receiving neuron.
A. 1,2,6,7,4,3,5
B. 3,5,6,2,7,4,1
C. 3,4,6,2,7,5,1
D. 2,3,6,7,4,5,1
E. 7,6,5,3,4,2,1
Biology
1 answer:
musickatia [10]3 years ago
6 0

Answer:

c

Explanation:

You might be interested in
Biological muscle cells can be thought of as nanomotors that use the chemical energy of ATP to produce mechanical work. Measurem
bearhunter [10]

Answer:

The answer is 6.4 × 10^{-20} Joules

Explanation:

This question wants to effectively test your knowledge of the names of the negative powers of 10, so first of all, before calculating, let me explain what each of the symbols in the units given in the question means:

Force = 8.0 pN = 8.0 × 10^{-12} N

displacement = 8.0 nm = 8.0 × 10^{-9} N

Now let us calculate the work.

work = Force × Displacement

work = 8.0 × 10^{-12}  × 8.0 × 10^{-9} = 64 × 10^{-21}

= 6.4 × 10^{20} Joules (in standard form)

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
The continental crust is _________ than the oceanic crust and seems to "float" on the mantle.
Natasha2012 [34]
C) Less dense

I hope that helps!
3 0
3 years ago
Read 2 more answers
This problem has been solved!See the answerFor aerobic respiration, a variety of substances must be in a state of influx across
nlexa [21]

Answer:

wefd

Explanation:

8 0
2 years ago
As the period of a wave increases, the frequency increases. Please select the best answer from the choices provided T F
tino4ka555 [31]
I'm pretty sure the answer is true. Hope this helps!

7 0
2 years ago
Other questions:
  • _____ is a medical intervention that goes through rigorous testing and evaluation of its benefits through randomized clinical tr
    15·1 answer
  • most female frogs lay their eggs in water male frogs release there sperm into the water to fertilize the eggs this is an example
    7·1 answer
  • Both the consumption of alcohol and the ingestion of antianxiety drugs work to increase the activity of __________, which is an
    11·1 answer
  • Meiosis and sexual reproduction are, in large part, responsible for genetic variation within a population. Meiosis supports gene
    10·2 answers
  • How does feedback inhibition affect enzyme activity?
    6·1 answer
  • Rajesh designed an experiment to test the effect of fertilizer on plant growth. The table on the right shows the data he collect
    7·2 answers
  • Earth's geochemical and biogeochemical cycles are important because they tend to maintain a balance of Earth's materials. true o
    13·1 answer
  • Which description is incorrect for the layers of the heart and its serous membranes?
    8·1 answer
  • The average number of individuals of the same species per unit of area or volume at a given time is the
    15·1 answer
  • Do we still have high tides and low tides during neap tides and spring tides? Yes or No?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!