The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
Encyclopædia Britannica, Inc. The forearm and the lower leg have two long bones each. In the forearm are the radius—on the thumb side of the forearm—and the ulna; in the lower leg are the tibia (the shinbone) and the fibula. The radius corresponds to the tibia and the ulna to the fibula.
Explanation:
Answer: Dinosaurs
Many forms of plants, invertebrates, and fishes evolved during the Mesozoic Era. Since the dinosaurs were the dominant animals on land then, the Mesozoic Era is called the Age of Reptiles. Dinosaurs, however, became extinct even before the end of the Era.
False; Alpha particles rarely penetrate human skin, but beta and gamma particles can and are considered very dangerous.
