1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
2 years ago
13

In sweet pea plants, an allele for purple flowers (P) is dominant to an allele for red flowers (p). Additionally, an allele for

long pollen grains (L) i dominant over an allele for short plan grains (l). Geneticist crossed plants that were heterozygous for both traits (PpLl X PpLl). What is the probability of producing plants with purple flowers and short pollen grains? 3/16 3/16 9/16 9/16 1/2 1/2 1/16
Biology
1 answer:
Tatiana [17]2 years ago
5 0

Answer:

P(purple, short) = 3/16

Explanation:

Purple flowers require genotypes Pp, pP or PP

Short pollen grains require genotype ll

The genotypes are

PPll (1/16), Ppll (1/16), pPll (1/16) for a total of 3/16

You might be interested in
A strawberry stem is an example of which of the following
Lelechka [254]
What ;( hola amigo :)
6 0
2 years ago
What gets passed from one cell to another in sexual reproduction
RoseWind [281]

Answer:

Cell division is the mechanism by which DNA is passed from one generation of cells to the next and ultimately, from parent organisms to their offspring. During meiosis, the cells needed for sexual reproduction divide to produce new cells called gametes.

8 0
3 years ago
Read 2 more answers
Why is the sequence of nucleotides important to the properties of a nucleic acid?
mart [117]

Answer: It retains and transmits important biological information.

Explanation:

5 0
2 years ago
Why can't astronomers measure the parallax of a star that is a million light years away?
motikmotik

One of the methods used widely to calculate the distance of nearby or closer objects in astronomy is Parallax. The distance of the stars are usually expressed in light years but the unit of distance is parsec or parallax second.  

                                        1 Parsec = 3.26 light years

Astronomers are not able to measure the parallax of a star that is a million light years away because the star is too far and the distance with which the start appears to move is too less to be calculated accurately.

6 0
3 years ago
__________ and __________ make up the Full Scale IQ score on The Wechsler Intelligence Scale.
Dmitriy789 [7]

Answer:

I believe it would either be A or D hope that helps sorry not much help

3 0
2 years ago
Read 2 more answers
Other questions:
  • Barbara is a research scientist at an organic pest control company. Part of her job is to find foods that ants will eat so the f
    6·1 answer
  • In chemiosmotic phosphorylation, what is the most direct source of energy that is used to convert adp + pi to atp?
    5·1 answer
  • What causes surface tension in water?
    15·1 answer
  • If you were to try and pair a thymine with a cytosine (a non Watson-Crick base pairing), then would you expect to see any stabil
    6·1 answer
  • 1. Independent variable:
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The outermost tissue of a tree trunk that is 6 feet in diameter would most likely be
    14·1 answer
  • Place the following events in the order in which they occurred on the vertical timeline. The first event and the last event have
    6·1 answer
  • A researcher while working in vitro (outside cell) added helicase enzyme which resulted in the untwisting of the DNA helix. But
    11·2 answers
  • What is the most important forage crop in the United States?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!