Answer:Environmental pollution is any discharge of material or energy into water, land, or air that causes or may cause acute (short-term) or chronic (long-term) detriment to the Earth's ecological balance or that lowers the quality of life. Pollutants may cause primary damage, with direct identifiable impact on the environment, or secondary damage in the form of minor perturbations in the delicate balance of the biological food web that are detectable only over long time periods.
Air pollution is the process which the substances and the energy forms are not present in normal atmospheric composition reach the atmosphere, or are present but in much lower concentrations.Air pollution is the introduction of chemicals, particulate matter, or biological materials that cause harm or discomfort to humans or other living organisms, or cause damage to the natural environment or built environment, into the atmosphere.
More than 3,000 substances that are not part of the atmospheric composition, falling in the atmosphere can be considered air pollutants.
Some substances that are normally present in the atmosphere in a certain concentration can be considerate pollutants because their concentration is much higher than usual concentration.
Also certain substances that are normally present in certain layers of the atmosphere (e.g. ozone in the stratosphere), once arrived in the troposphere is pollutant.
Some gases, such as oxides of nitrogen may have beneficial effect on vegetation, after hydration may affect the leaf fertilizer.
The air pollutants factors can be chemical (chemicals), mechanics (particles in suspension) physical (ionizing radiation) and acoustic (noise).
Explanation:if this helped mark me brainliest
Answer:
Birds, like mammals, have a 4-chambered heart (2 atria & 2 ventricles), with complete separation of oxygenated and de-oxygenated blood. The right ventricle pumps blood to the lungs, while the left ventricle pumps blood to the rest of the body.
<h3>
<u>PLEASE</u><u> MARK</u><u> ME</u><u> BRAINLIEST</u></h3>
<u>
</u>
Answer:
They have a plasma cell membrane, a nuclear region and a cytoplasm.
Explanation:
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
