1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
3 years ago
7

Help me pleeeeeaaasssseeee

Biology
1 answer:
IrinaK [193]3 years ago
7 0
Sorry but I don’t know
You might be interested in
Which climate condition is typically found in the tropics due to the interaction of the atmosphere and hydrosphere?
ivolga24 [154]

Answer:

Option (C) is correct i. e. , wet with high humidity.

#$# THANK YOU #$#

5 0
4 years ago
Describe three ways that the transverse waves of the electromagnetic spectrum are used in
prisoha [69]
I hope that can help you.

7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Babies with very low or very high birth weight are less likely to survive. Observe a graph of the data.
vaieri [72.5K]

I need to see said graph but to my understanding most under weight babies are born early so their body is not fully developed but as an slightly over sized baby myself the biggest problem was for my mom because she had to have a c section because I was too big to come out the normal way

by the way c section stands for Cesarean section

hope all this helps

6 0
3 years ago
Which tiny, round “factory” puts together protein and is often found in the endoplasmic reticulum? A. chromosome B. chloroplast
WITCHER [35]
D. Ribosome

Proteins are manufactured on ribosomes, which are found in the rough ER. The rough ER is called this for the rough appearance the ribosomes give it.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Male birds of two different species living on the same island have developed different mating behaviors, as
    15·1 answer
  • Which of the following is a renewable resource?
    7·2 answers
  • What are the functions of the proteins that mRNA helps to produce?
    13·1 answer
  • What is the endosymbiotic theory? (Cells)
    10·1 answer
  • Solutions to stop dams
    14·1 answer
  • Question 19
    12·1 answer
  • Match the following terms with their best/ most reasonable descriptions: Group of answer choices self-propagating mechanism by w
    8·1 answer
  • Elizabeth has always believed that people’s thoughts can help heal them. She wants to help people use positive thinking to posit
    10·1 answer
  • Please answer and explain if you can<br> 1. What factors can limit cell size?<br> Answer:
    10·1 answer
  • the discovery of rna interference (rnai) led to its use in biotechnology and medicine. all of the following are examples of how
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!