1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ikadub [295]
3 years ago
5

Percentages of Nucleotide Differences in Chloroplast Genomes

Biology
1 answer:
Yakvenalex [24]3 years ago
4 0

Answer:G. thurberi

Explanation: because you can really tell. Correct

You might be interested in
Which kind of disturbance is most likely to precede primary succession?
inessss [21]
Visual disturbance is the most likely to precede primary succession
4 0
4 years ago
Read 2 more answers
How did qualitative, chemical,and enzyme test help avery identify DNA as the transforming principle
Rufina [12.5K]
<span>Avery Identified through a qualitative test that DNA was present. Through a chemical test he found that the make up was DNA. Through enzyme testing Avery found that only DNA degradation stopped transforming.</span>
6 0
4 years ago
PLEASE HELP?
Mamont248 [21]
1.) DNA replication is a process where the double helix is unwound and each strand is replicated to create another. This occurs in all replication of the body cells, or reproductive cells, a common process called mitosis.

2) The original DNA molecule is exactly the same as the replicated molecule, but the original is called the parent cell and the replicated molecule the daughter cell.

3) Enzymes act as catalysts/proofreaders of DNA replication. For example, Primase synthesizes RNA primer, or DNA ligase joins DNA strands together.
8 0
3 years ago
Read 2 more answers
Which of these describes a difference between viruses and cells? Your answer: A. Cells contain protein, and viruses contain only
Maksim231197 [3]
B. Cells reproduce independently and viruses require a host to reproduce
3 0
3 years ago
What is the correct amino acid sequence for the given DNA sequence,TACACGTTCACC?
Akimi4 [234]

Answer:

ATGTGCAAGTGG

Explanation:

A=T

C=G

G=C

T=A

Hope this helps you out!

5 0
3 years ago
Other questions:
  • Which of the following describes a scientist behaving in an unethical manner might? A scientist who revises a hypothesis that ha
    14·1 answer
  • What does the term "limiting factors " mean? name did examples for a jackrabbit in the desert.
    14·2 answers
  • What two or three organisms are most important in the mono lake ecosystem?
    14·1 answer
  • What could be achieved by DNA profiling using gel electrophoresis?
    12·1 answer
  • 10. In angiosperms, a _____ is contained in the anthers or ovaries, and the _____ consists of the rest of the plant. sporophyte;
    10·1 answer
  • Hydrogen bonds give water which of the following properties? 1. high pH low pH the ability to resist temperature changes 2. the
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • At one time, dinosaurs lived on Earth. Today they are extinct. This relates to​
    13·1 answer
  • The main function of this macromolecule include muscle development, catalyst activity and defense against disease
    6·1 answer
  • N
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!