1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
2 years ago
7

Explain why you think the G1 phase shows the most variation in length.

Biology
1 answer:
Aleonysh [2.5K]2 years ago
4 0

Answer: cuz G1 is the most largest number to all the regular numbers

Explanation:

You might be interested in
Define ecological succession <br>​
enot [183]
Ecological succession is the process of change in the species structure of an ecological community over time. The time scale can be decades, or even millions of years after a mass extinction
7 0
2 years ago
A scientist who studies macroevolution would probably _____.
notsponge [240]
The best answer would be "research reasons why species change over long periods of time" 

if not i apologize but this is my best guess<span />
6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
14. A structure with a chain of carbons and hydrogens with a COOH at the end will represent which of
pychu [463]

Answer:

The correct answer is a Protein

Explanation:

Proteins are macromolecules consisting of amino acids which are joined by peptide bonds.

         Protein molecule has two ends,  amino(-NH2) group is present at one end that is known as amino terminal end or N terminal end whereas carboxyl group is present at the another end that is called carboxy terminal end or C terminal end.

3 0
2 years ago
The aorta is a vein. True False
Kamila [148]

False, the aorta is the major artery that takes oxygenated blood from the heart to the rest of the body.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Why does an orbiting satellite's speed remain constant?
    7·1 answer
  • Nitrogen is made available in a useful form for animals in the A. fertilizers they absorb. B. plants they eat. C. air they breat
    5·1 answer
  • Who invented aneroid barometer?
    14·1 answer
  • Which one of the following is NOT a characteristic of DNA Vaccine?
    9·1 answer
  • The top of the saturated zone is called the
    9·2 answers
  • In November 2004 the floodgates of Glen canyon Dam opened in attempt to improve the Colorado river habitat .The release topped 1
    12·1 answer
  • What function do cilia have in the respiratory system?​
    12·2 answers
  • The degree or intensity with which a particular genotype is expressed in a phenotype is its
    13·1 answer
  • A model that shows a single sequence of feeding relationships is called a
    13·1 answer
  • According to fossil records, the horses that lived 50 million years ago were much smaller, weaker and slower than modern horses.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!