1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
3 years ago
6

Question 3 (Mandatory) (3 points)

Biology
1 answer:
maksim [4K]3 years ago
3 0

Answer:

water

Explanation:

..............

......

You might be interested in
What would happen if all the major mountain ranges, particularly in the north hemisphere were gone? The Rockies, Himalayas, the
mylen [45]

Answer:

These big and hefty mountain ranges are play important role in weather and wind patterns in their related geographical region. Mountain ranges such as Himalayas, Rockies and Alps affects the weather and movement of wind on global level as well.

In absence of these mountains the global pattern of the wind can be affected and cause drastic change in global climate change as they play crucial role as barrier to wind and jet streams by diverting or dividing it.

For instance Himalayas, during the northern winters diverts the wind and acts as barrier for wind which prevents it from freezing. Rockies and Andies blocks the moisture laden winds flow from Pacific Ocean to western flanks of the american continent that leads to a dry region called rain Shadow desert zone.

Hence if these mountain ranges are gone these impacts will not be felt. Similarly Himalayas in India, cause monsoon wind to strike and cause rain in the region. So winds are greatly affected by these Mountains. If these mountain ranges were gone, winds will flow undisturbed as there would be no barrier to global wind patterns.

6 0
3 years ago
What energy is energy that has not yet been used
Makovka662 [10]

Potential energy or stored energy.

7 0
3 years ago
Read 2 more answers
A nucleotide is about to be added to a growing strand of DNA. What factor determines which type of nucleotide will be added? A.
astraxan [27]
D. Base pairing rules
8 0
3 years ago
What is a niche??????????
Juli2301 [7.4K]
I have no idea search it up in google
6 0
3 years ago
Read 2 more answers
Infer the kind of succession that will take place in an abandoned, unpaved country road
Delvig [45]
Secondary succession is the infer kind of succession that will take place on an abandoned, unpaved country road.
Secondary succession is termed as one of the two types of ecological succession in the life of a plant.
It is a process which is being started by an event for example harvesting, hurricane, and forest fire. which reduces an established ecosystem. Secondary succession occurs in a pre-existing soil and it is the ecological succession that occurs after the initial succession which has been disrupted and some animals and plants still exist.
8 0
3 years ago
Other questions:
  • What performs photosynthesis in a food chain
    14·2 answers
  • What are two examples of heat or pressure that can form metamorphic rock?
    11·1 answer
  • The inner membrane of the mitochondrion is folded into cristae. The cristae the surface area of the inner membrane, the mitochon
    14·2 answers
  • Why is there no such thing as heterozygous recessive
    13·2 answers
  • Describe the difference between clastic and organic sedimentary rocks.
    9·1 answer
  • On topographic maps, contour lines that are close together indicate?
    11·1 answer
  • Someone please help i’ll give brainliest.
    9·2 answers
  • If the slope of a distance-time graph is steep, then the speed of the object must be
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Explain one way that that the sun can change the state of matter (liquid, gas, and solids).
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!