1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FromTheMoon [43]
3 years ago
9

How does your choice of behaviour effect your ability to achieve your goals?​

Biology
1 answer:
Aloiza [94]3 years ago
7 0
An example of how someones choice can effect someone’s ability to achieve ones goal can be when someone is dissatisfied of something that has recently occurred and, is thinking about something else when trying to complete a task such as when writing a paper.
You might be interested in
How would you explain the reasons for dividing time into four eras? What are the major characteristics of each era? *
Blababa [14]

Answer:

Eons, Eras, Periods, Epochs.

Explanation:

8 0
3 years ago
Read 2 more answers
How are individual atoms of oxygen formed in the stratosphere?
Marrrta [24]

Answer:

the answer is d

Explanation:

Individual oxygen atoms are formed when UV rays strike oxygen molecules.

8 0
2 years ago
Which of the following eat producer organisms in a food chain?
svlad2 [7]

Answer:

Herbivore

Explanation:

4 0
3 years ago
Determine whether each of the following statements about sulfur oxide and/or nitrogen oxide pollution is true or false. a. A car
alina1380 [7]

Answer:

The topic of atmospheric pollution and the damage that pollutant gases produce on our atmosphere has been a raging one for decades now.

Pollutant gases, like sulfur oxide and nitrogen oxide, which are released into our air from various sources due to the use of fossil fuels, are part of the reason why today we can talk about acid rain. Acid rain is an unnatural event in which the acidity present in the water that comes down from clouds due to the mixture of water vapor with nitrogen oxide and sulfure oxide, is much higher than normal. And the damages to our planet are very extensive.

As such, the answers to your questions would be:

1. A car´s catalytic converter removes nitrogen oxide pollution and is most efficient at room temperature: True. This is because catalytic converters have an optimum operating temperature, and when a car´s engine has just been started, or has been exposed to cold, the converter will take some time to become fully operational.

2. The largest source of sulfur oxide pollution is burning coal for power plants: True. This, unfortunately, is still true in today´s world. Power plants still largely use fossil fuels, and most importantly coal, as their power source, and coal, when burned, produces abundant amounts of sulfur oxide.

3. Most nitrogen oxides formed during combustion come from nitrogen in the fuel: True. According to the EPA, even with the work done to resolve this, combustion of gasoline, rich in nitrogenous elements, produce release of nitrogen oxides.

7 0
3 years ago
For your organ system, describe how the system works at the organ level. please help I don't understand
sashaice [31]
What organ system are you talking about
4 0
3 years ago
Other questions:
  • ​the genetic code is made up of units consisting of how many nucleotides
    7·1 answer
  • Alicia often travels from the very hot climate of South Africa to her native North America. Which sensory receptor helps her adj
    12·2 answers
  • 2. Coca-Cola tested a version of Diet Coke containing a new type of
    9·1 answer
  • Which of the following is not a component of the hepatic triad found at the edges of a liver lobule?
    8·1 answer
  • Please fully explain the answer​
    7·1 answer
  • What is gene flow?
    5·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Describe in your own words how a plant with a yellow pod can have two green-pod parents.
    9·1 answer
  • Veins have valves which allow blood to flow only in one direction. Arteries do not have valves. Yet the blood flows in one direc
    14·2 answers
  • The Philadelphia chromosome results when a portion of chromosome 9 is swapped for a portion of chromosome 22. This type of mutat
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!