The answer is : A ) separate DNA fragments
Answer: Yes
Explanation:Most yeasts reproduce asexually by budding: a small bump protrudes. A few yeasts reproduce by fission, the parent cell dividing into two equal cells.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.
