1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrew [12]
2 years ago
14

A string is pulled tight. A machine causes it to vibrate at different frequencies. What will happen to the vibrations in the str

ing when they are vibrating at their resonant frequency?
A.
The amplitude of the vibrations will increase.
B.
The frequency of the vibrations will increase.
C.
The wavelength of the vibrations will increase.
D.
The period of the vibrations will increase.
Biology
1 answer:
Novay_Z [31]2 years ago
3 0

Answer:b

Explanation:

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What a square and how is its used?
zmey [24]

Answer:

A square is a mathematical shape that has 4 sides and 4 corners. It has equal sides and is used for the graph paper squares or tiles.

6 0
3 years ago
Natural selection can be described as all of the following EXCEPT Question 1 options:
kiruha [24]
Survival of the strongest... an organisms strength does not affect the natural selection process. Natural selection is adapting the species to be able to better survive in its environment. In order to better survive, an organism does not to be strong. e.g. a plant is probably not a “strong” organism and natural selection doesn’t change that in most cases
4 0
3 years ago
Which of the following structures are present in plant cells but absent in animal cells ?
Paladinen [302]

Answer:

Plant cells have a large central vacuole, a cell wall, and chloroplasts while animal cells do not.

Hope this helps!

4 0
2 years ago
Read 2 more answers
What caused the disappearance of land bridges?
kogti [31]
C. The Bering Land Bridge once connected what would be Russia and North America but the the movement of these continents separated the land bridge
8 0
3 years ago
Read 2 more answers
Other questions:
  • The uppermost zone in lakes and ponds, which is close to the shore and rich in nutrients is called the _______.
    8·1 answer
  • 1. Mendel was the first person to succeed in predicting how traits are?
    15·2 answers
  • What a different between meiosis and metosis
    13·1 answer
  • What kind of molecule passes through the lipid belayer of the cell membrane
    15·1 answer
  • BRAINLIESTTT ASAP!!!!<br><br> Explain what Lunar phases are in specific detail in one paragraph.
    14·1 answer
  • TRUE OR FALSE
    14·1 answer
  • Identify the molecule that is produced during both photosynthesis and cellular respiration to power chemical reactions.
    10·1 answer
  • Look at picture. pls help
    11·2 answers
  • Use what you know about the number of faces, vertices, and edges in polyhedrons to choose True or False for each statement.
    15·1 answer
  • Choose all the answers that apply. Which of the following is a source of watershed pollution? pesticide fertilizer animal waste
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!