1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
labwork [276]
3 years ago
5

1. Which molecules are used to create cellular respiration (INPUT)?

Biology
1 answer:
Alex3 years ago
7 0

Answer:

Cellular respiration

Explanation:

You might be interested in
What is a chromosome?
Morgarella [4.7K]

Answer:

A chromosome is a deoxyribonucleic acid molecule with part or all of the genetic material of an organism

Explanation:

4 0
3 years ago
Read 2 more answers
I'm stuck. help anyone?
crimeas [40]

the answer would be b because b is the only one that changes while a and c does not change for their type.

hope this helps! ❤ from peachimin :)

8 0
3 years ago
Read 2 more answers
Historically, African elephants have had large ivory tusks. For many years, poachers (illegal hunters) have been killing elephan
Naily [24]

The Answer is A

~VERNEX

6 0
3 years ago
Read 2 more answers
Why do composite cone volcanoes have the most violent eruptions?
Aloiza [94]

Answer:

bc it has cities surrounding it

Explanation:

7 0
3 years ago
Read 2 more answers
According to scientists, ocean waves could be a source of energy. Devices are being designed to capture the energy from waves an
Tcecarenko [31]
The benefit is that capturing the energy from the waves is another source of replenishable energy (like solar or wind power)
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which important complex is formed due to complimentary binding at the enzyme active site?
    14·2 answers
  • Many health authorities recommend that Americans consume within
    15·1 answer
  • Where is sugar removed and how can you tell​
    9·1 answer
  • Please help, what is a good topic sentence for a DNA paragraph
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the relationship between organelles and homeostasis?
    11·1 answer
  • 2. Lisa breeds snakes. She bred a solid brown male python with a tan female python whose body was covered with a black diamond p
    15·2 answers
  • Which of these categories of Linnaean classification contains all the others?
    15·1 answer
  • Describe what happens by the end of anaphase.
    13·1 answer
  • A commensal bacterium Group of answer choices does not receive any benefit from its host. is beneficial to its host. may also be
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!