1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marat540 [252]
3 years ago
15

What was Mendel's explanation for the fact that 0% of the offspring from this cross were green?

Biology
1 answer:
VMariaS [17]3 years ago
5 0
So Mendel got roughly 75% yellow and 25% green in f2. This means that f1 contains all heterozygous genes, as shown below

Y y
Y YY Yy
y Yy yy
Summary: 75% YY or Yy, 25% yy

Which means that green (y) is a recessive phenotype, while yellow (Y) is a dominant phenotype, since plants with heterozygous genotype Yy express the yellow trait.
You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which statement correctly summarizes Wegener’s theory of continental drift?
GuDViN [60]

The correct answer would be D), over millions of years, Pangaea broke apart and drifted to form the seven continents.

7 0
4 years ago
Read 2 more answers
An analysis of a sample of urine, shows the presence of blood cells and glucose. Account for the presence of these substances in
erica [24]

Answer:

It could mean that your kindneys arent filtering your blood properly

8 0
3 years ago
. Which plane divides the body into upper and lower parts?
LekaFEV [45]
Coronal according to quizlet

5 0
3 years ago
An area in the _______ called the ___________ is specialized to recognize faces.
diamong [38]
I think your answer is B. temporal lobe; ffa
4 0
3 years ago
Other questions:
  • The second part of the mitotic phase, during which cell division is completed by the physical separation of the cytoplasm compon
    12·1 answer
  • List the 6 steps in the food Flow system:
    15·1 answer
  • Which electron carrier is generated in the reaction catalyzed by malic enzyme?
    14·1 answer
  • Piper touches a block of ice, and she feels that it is very cold. How does she feel the sensation of cold?
    7·1 answer
  • An elongated tailbone occurs rarely in some newborn children. What does the presence of a tailbone indicate?
    11·1 answer
  • What did Phoebus Levene discover
    7·1 answer
  • What is the most important plant?
    7·1 answer
  • A boxer has been jumping rope for an hour. His leg muscles are burning and he feels weak. Which of the following most likely exp
    13·1 answer
  • Trùng roi giống thực vật:
    5·1 answer
  • Outcome of pancreaticoduodenectomy with pylorus preservation or with antrectomy in the treatment of chronic pancreatitis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!