1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fittoniya [83]
3 years ago
6

Name the type of classifications of tissue formed by combination of cell.

Biology
1 answer:
RSB [31]3 years ago
7 0

Answer:

its (a)

Explanation:

<h2>A tissue is a group of red blood cells of common origin which are structurally similar and perform a particular function. Organ is a group of tissues and organ system is a group of organs.</h2><h2>Therefore, the correct answer is option A.</h2>

<h2>hope it helps you.</h2>

<h2>pls mark me as branliest </h2>
You might be interested in
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
The forehead is _______ to the ears.
V125BC [204]
I would say superior but since it isn’t on here then maybe distal?
3 0
3 years ago
Read 2 more answers
Which of these explain how ice cores can be used to correlate atmospheric makeup and climate changes over time?
Fynjy0 [20]

Answer:

C if you are in USATestPrep

3 0
3 years ago
What is an accretionary wedge briefly describe its formation?
tatiyna
Accretionary wedge is formed when sediments accreted to the non subducting tectonic plate at a convergent plate boundary. Materials in the accretionary wedge are usually marine sediments that are scrapped off from the down going slabs of oceanic crust. Elevated regions within the ocean basin are transported towards the subduction zones and accreted to the continental margin.
3 0
4 years ago
Under a microscope, a student observes a specimen containing a cell wall, nucleus, and chloroplasts.
mart [117]

Answer:

A plant cell b/c it has chloroplast

Explanation:

Chloroplast absorbs sunlight also known as light energy used for the process of photosynthesis.

5 0
4 years ago
Read 2 more answers
Other questions:
  • The food you eat is processed during cellular respiration to produce stored chemical energy in the form of __________, _________
    8·2 answers
  • What are 3terms uses to describe organisms such as humans?
    15·2 answers
  • Help asap, it is easy!! first answer gets BRAINLIEST!
    11·1 answer
  • Select all that apply.
    6·2 answers
  • Which of the following is true for a cell that has a nucleus
    8·1 answer
  • The (matrix / stoma / cytoplasm / nucleolus) is the innermost compartment of a (cytoplasm / cell wall / mitochondrion / nucleus)
    15·1 answer
  • Who Discovered that there was the same amount of A and T in a cell, and C and G in a cell.
    15·1 answer
  • Which forms of precipitation are more likely to occur when temperatures are above freezing?
    8·2 answers
  • Please select the word from the list that best fits the definition
    15·1 answer
  • GENES
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!