1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
schepotkina [342]
3 years ago
9

What’s the largest county in Florida

Biology
2 answers:
Katen [24]3 years ago
3 0

Miami Dade is the correct answer. Hope you like my answer.

Firdavs [7]3 years ago
3 0

Answer:

Miami-Dade County

I also live in Florida but i'm Hillsborough County.

You might be interested in
How do different cells in the body keep you alive?
Semmy [17]

Answer:

every cell in you body needs oxygen to help it metabolize it release from food for energy.cells that do the same job combines together to form body tissue such as muscles,skin bone tissue.cells can take in fuel.cells not only make up living things,they are living g things.

3 0
3 years ago
Groups of individuals that belong to the same species and live in the same environment
MissTica

Answer:

This is known as Population.

Explanation:

A population is made up of organisms of the same kind living together in the same habitat. Characteristics of a population include the population size, frequency, density, percentage cover and distribution.

Factors that dominantly affect a population comes up especially in size and distribution. These factors include; migration of organisms to other habitats, invasion or colonization by new species, increase or decrease in birth and death rates etc

4 0
3 years ago
How do planets and stars differ from one another
Andreas93 [3]
Stars are balls of gasses while planets are gasses and rock
4 0
3 years ago
For which of the following pairs does the molecule given as the first term on the left contribute to the synthesis of
netineya [11]

Answer: B) amino acid - protein

Explanation:

5 0
3 years ago
Many bacteria, such as
VladimirAG [237]
T(°F) = T(°C) × 1.8 + 32

Therefore, the answer is 98.6 degrees Fahrenheit
4 0
4 years ago
Other questions:
  • Outline and describe the steps in the process represented in this diagram
    12·1 answer
  • Can photosynthesis happen in the dark?
    14·2 answers
  • The table shows the energy that is stored in three types of organic molecules. Energy Storage in Humans A 4-column table with 3
    6·2 answers
  • One of the most common types of bacteria-related diarrhea in the united states, resulting primarily from the ingestion of contam
    5·1 answer
  • How much solar energy does the world use?
    13·1 answer
  • 01.03]Which of the following statements about science is true? Science is built on opinions and assumptions. Science is tested b
    14·2 answers
  • What is a karyotype?<br><br> 35 POINTSS!!
    13·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Pros and cons of penguins in huddles
    11·1 answer
  • Cells have what type of bilayer that is not
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!