1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
3 years ago
8

Why do population stop increasing when they reach carrying capacity

Biology
2 answers:
Brrunno [24]3 years ago
6 0

Answer:

Because they will die off

shtirl [24]3 years ago
4 0

Answer:

As the population increases, the food supply, or the supply of another necessary resource, may decrease

Explanation:

You might be interested in
Due to the fact that these bacteria are adapted to extreme habitats, where are you most likely to find bacteria belonging to the
Assoli18 [71]

The answer to the above question is in a hot spring.

<h3>What is a habitat?</h3>

The term "habitat" in ecology refers to a region's collection of biotic, physical, and resource elements that are present to support a specific species' ability to survive and reproduce. It is possible to think of a species' habitat as the outward representation of its biological niche. As a result, "habitat" refers to a particular species, which is fundamentally distinct from ideas like "environment" or "vegetation assemblages," for which the term "habitat-type" is more applicable.

To learn more about habitat with the help of given link:

brainly.com/question/728057

#SPJ4

6 0
2 years ago
What is the role of lysozyme?
Fudgin [204]

Answer:

Explanation:

i dont kniw

8 0
2 years ago
Read 2 more answers
In vertebrates such as a chicken, a mouse, of a python, variation in the number of vertebrae in the spine is determined by Hox g
andriy [413]

Answer:

I think the answer is C.

Explanation:

C.

3 0
3 years ago
A specimen smaller than 0.2 micrometers must be completely dried out before being studied using this type of microscope
Shalnov [3]
Bright-phase microscope
6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Choose the one word that does not describe natural selection? *
    14·1 answer
  • How can sedimentary be changed through igneous rocks and then into metamorphic rocks
    7·1 answer
  • Cytokinesis allows the cell to divide, creating with copies of DNA.
    15·2 answers
  • Cual es la moneda energética de la célula?<br>​
    11·2 answers
  • When are spindle fibers present?
    8·1 answer
  • Subduction is not always accompanied by compression and thrust faulting in the overriding plate. this is especially true when:
    12·1 answer
  • Which landform is part of the cryosphere? glacier lake ocean river
    12·2 answers
  • which statement describes the relationship between chromosomes, genes, and alleles? a. alleles move genes to a specific location
    5·1 answer
  • I NEED HELPPPP PLEASEEEEEE :OOOOO
    11·2 answers
  • Please and thank you
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!