1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Digiron [165]
3 years ago
7

1. How would removing the Gypsy month affect the blue jay population ?

Geography
1 answer:
aleksklad [387]3 years ago
6 0

Answer:

This moth is a significant pest because the caterpillars have voracious appetites for more than 300 species of trees and shrubs, posing a danger to North America's forests. The caterpillars defoliate trees, leaving trees vulnerable to diseases and other pests and can eventually kill the tree.

Explanation:

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
PLZZZ HELP ME I HAVE 40 POINTS AND BRAINLIEST
sattari [20]

Answer:

Land is the least effective because most disasters that occur are caused by either air or water...air pollution or flood.

7 0
3 years ago
Which ocean zone contains the remains of dead organisms and other matter that has settled to the ocean floor?
ss7ja [257]
Twilight zone because the twilight zone is the deepest part of the ocean
8 0
3 years ago
Read 2 more answers
How is location determined?
Anettt [7]
Location is determined by longitude and latitude.
3 0
3 years ago
Help ,,,,,,,,,,,,,,,,​
Andru [333]

Answer:

<u><em>B. Water Temperatures </em></u>

Explanation:

It was warm so people didn't die from cold at all

6 0
3 years ago
Other questions:
  • Which of the following political theorists and philosophers were in favor of capitalism
    12·1 answer
  • Easy way to remember which is which for longitude and latitude?
    7·2 answers
  • This US region is currently experiencing population growth. it is a major agricultural region for growing citrus,tobacco,and cot
    14·1 answer
  • Animism––a belief system in which natural features, including plants and animals, are believed to have spiritual powers––is the
    14·1 answer
  • Why is it difficult to interpret the rock record of Precambrian Time?
    12·1 answer
  • Under the leadership of Mikhail Gorbachev, the doctrine of perestroika called for which of the End of exam following? A. Opennes
    12·1 answer
  • Which international organization would attempt to make peace between Somalia and a neighboring country if tensions existed betwe
    6·1 answer
  • Explain the effect of mining on the environment<br>​
    7·2 answers
  • Early wild dogs were a _____ to be used for protection​
    15·1 answer
  • Why are trade barriers necessary for protecting employment​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!