1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
2 years ago
10

The principle of dominance is a inheritance pattern. It states traits that are

Biology
1 answer:
zvonat [6]2 years ago
4 0

Answer:

This question is incomplete, it is asking to fill in the missing gaps as follows:

The principle of dominance is a ______ inheritance pattern.

It’s states traits that are ______ mask the traits that are______

The answers to the missing gaps are: MENDELIAN, DOMINANT, RECESSIVE

Explanation:

Gregor Mendel proposed the principles that govern inheritance. These principles are called MENDELIAN inheritance pattern because they align with or follow the principles of Mendel. One of these principles by Mendel is the LAW OF DOMINANCE.

Mendel has previously stated that there are two alleles for each gene. Each contrasting allele encodes a different phenotype. However, the law of dominance states that one of these two alleles called DOMINANT allele has the ability to mask the phenotypic expression of the other allele called RECESSIVE allele. In other words, a dominant trait will mask the recessive trait.

For example, in a gene Tt, allele 'T' for tallness is dominant and hence, will mask the phenotypic expression of allele 't' for shortness. This means that the tall trait (dominant) will mask the short trait (recessive) as explained by Mendel's law of dominance.

You might be interested in
The resting cell normally has a net negative charge with respect to the outside of the cell. what is this state called?
Zolol [24]
The answer is <span>polarized </span><span>state.</span>
5 0
3 years ago
Write TRUE or FALSE
Natasha_Volkova [10]

Answer:

TRUE

Explanation:

3 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which type of energy can be sensed by the ears?
ElenaW [278]
Type of energy that can be sensed by the ears is sound energy.
A.
6 0
3 years ago
Read 2 more answers
PLS HELP WILL GIVE BRAINLIEST
Marizza181 [45]

Answer:

Food chain shows only one part of animal and the food they consist of while food web shows different animals and different type of food they eat. Food chain is part of food web

5 0
2 years ago
Other questions:
  • Plasmodium, the world’s most lethal parasite, causes malaria. The parasite enters the
    15·1 answer
  • Fungi of the phylum Basidiomycota form mycorrhizal associations with orchids, a type of flowering plant. How do these associatio
    11·2 answers
  • Why is biomass considered a renewable resource?
    13·2 answers
  • 20.
    12·1 answer
  • (Does heating water allow it to dissolve more sugar)? What is the Dependent Variable, What is the Independent Variable?​
    14·1 answer
  • Neuroscience research has found that _____ produces positive structural changes in the brain..​
    10·1 answer
  • What are the products of light-independent reactions?
    7·2 answers
  • How would a functional sociologist view the Burqa?
    15·2 answers
  • What is the elephant getting when the bond is broken in sucrose?<br>​
    8·1 answer
  • Where do rift valleys form?<br> Rift valleys form where 2 ___________ plates ________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!