1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
3 years ago
6

List 2 examples of a human's first line of defense:

Biology
1 answer:
Verizon [17]3 years ago
5 0

Answer:

The first line of defence (or outside defence system) includes physical and chemical barriers that are always ready and prepared to defend the body from infection. These include your skin, tears, mucus, cilia, stomach acid, urine flow, 'friendly' bacteria and white blood cells called neutrophils.

You might be interested in
Fruit flies have a diploid number of 8 and have a diploid number of 32. In which case will crossing over have greater impact on
Dovator [93]

Answer:

Diploid cells are like daughter cells coming from a mother cell called a haploid cell. So the more daughter cells are born, the greater the chance of getting hybrids and creating more diversity on the genetic races existing. In this case, the answer would have to be honeybees.

Explanation:

7 0
3 years ago
What are some bad things about ribosomes?
Orlov [11]
<span>Mutations in small ribosomal subunit biogenesis proteins that cause disease</span>
5 0
3 years ago
Type 3 claims explains why water levels mead have changed?
iragen [17]

Answer:i dont even know

Explanation:

4 0
3 years ago
Which of the following agents of erosion would be the direct cause of a landslide?
andreyandreev [35.5K]

Answer:

A.

Explanation:

because the gravity will drop

8 0
3 years ago
Why do many desert plants have small leaves?
maksim [4K]

small leaves protect desert plants from animals that eat plants.

5 0
4 years ago
Read 2 more answers
Other questions:
  • Glycolysis is the process of converting glucose into pyruvic acid. Where does this process occur?
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • MULTIPLE ANSWERS
    13·2 answers
  • Scientists have found that the hedgehog signaling pathway is active in embryos during the early development of the neural tube,
    12·1 answer
  • Each dot that makes up a satellite image is called a pixel.   Please select the best answer from the choices provided T F
    9·2 answers
  • Where on a horse's body would you find the withers?
    9·1 answer
  • Which bases are found in a strand of dna? thymiwhich bases are found in a strand of dna?
    10·2 answers
  • The ________ perspective on sexual deviance stresses the point that social life revolves around varying definitions of reality a
    14·1 answer
  • Organisms in the Euglenophyta are
    6·2 answers
  • QUE ES ELECTRIZACIÓN​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!