Answer;
-Bradycardia
-Heart block
-Asystole
Explanation;
-Tracheal suctioning can cause a vagal response. This stimulus influences the electrical system of the heart, potentially leading to decreased heart rate (bradycardia), heart block, asystole, or other dysrhythmias.
-Bronchospasm would not be induced by this type of stimulus. Vagal stimulation can result in hypotension, not hypertension.
Differences between<span> a </span>physical and chemical change<span> in matter or substances</span>
Hello!
Yellow = Y
Green = y
Based on the fact that 25% of the offspring inherited two recessive alleles (we know this because in order for a recessive allele to be expressed, it must be homozygous),<u><em> the parent peas had to both be heterozygous. </em></u>
Yy * Yy will always result in:
1/4 = yy
2/4 = Yy
1/4 = YY
I hope I helped!
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
a) another living cell
Explanation:
"All living cells arise from pre-existing cells by division."
