1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka [77]
2 years ago
15

Please answer asap!

Biology
1 answer:
maksim [4K]2 years ago
6 0
Ndjdksowoskskdkdl I’m just kidding lol I’m sorry I’m
You might be interested in
Compare and contrast the 2 growth patterns
Digiron [165]
In what organisms are you referring to?
6 0
3 years ago
Read 2 more answers
The Champaign-Urbana area has long been suffering from the heinous pathogenic bacterium, Michiganious wolverinous, which causes
Nadusha1986 [10]

Answer:

The correct answer is option a, that is, 3000 cases.

Explanation:

The measurement of all the individuals getting influenced by the disease at a specific time is known as the prevalence. On the other hand, the measurement of the number of novel individuals that came into contact with a disease during a specific time duration is known as the incidence.  

Based on the given question, the number of prevailing cases carried from 2018 to 2019 is 2000, and the new diseases recorded in the year 2019 is 1000 (incidence). Therefore, the prevalence of the disease in 2020 will be 3000 cases.  

6 0
4 years ago
Which of the following is a measure of the biodiversity of an ecosystem?
SSSSS [86.1K]

Answer:

C

Explanation:

Biodiversity is the difference and variation in a given area

6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
QUESTION 18 HELPPPPP
aleksley [76]

Answer: the answer is the last one transcription takes place on the nucleus and translation takes place in the cytoplasm

Explanation:

3 0
3 years ago
Other questions:
  • What is a term that means the ability of leukocytes to move in and out of blood vessels in order to reach sites of inflammation
    15·1 answer
  • Biceps are made mostly of _____. neurons, squamous epithelial, cells, skeletal muscle, smooth muscle
    13·2 answers
  • One of the structures that is unique to angiosperms
    6·1 answer
  • Peanut butter and cottage cheese each provide which two sources?
    14·2 answers
  • What are the characteristics of carbon bonds?
    5·1 answer
  • Match the following terms and definitions. 1. two or more units are added together to form a new compound law of mass action 2.
    10·1 answer
  • Looks like mitosis metephase
    12·1 answer
  • Explain how DNA samples made it possible to identify victims found at Creompaz.
    8·1 answer
  • PLS HELP, HELP HHHHEEEELLLLPPPP
    11·1 answer
  • Essay about why people should not join a gang​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!