1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetlanka [38]
3 years ago
6

Dose bacteria have a nucleus

Biology
2 answers:
Ksenya-84 [330]3 years ago
4 0

Answer:

they don't have

Explanation:

Bacteria are considered to be prokaryotes, which means they do not have a nucleus

insens350 [35]3 years ago
3 0

Answer:

yes

Explanation:

You might be interested in
A property of life known as energy processing refers to the fact that living things:_______.A. can reproduce.B. obtain energy fr
maksim [4K]

Answer:

B

Explanation:

7 0
3 years ago
Read 2 more answers
According to the all-or-none law, ____.​
Sav [38]
Neurons produce an action potential at the same time or none at all
4 0
3 years ago
A small cell has a larger plasma membrane surface area than does a large cell.
SVEN [57.7K]
Is  this a true or false question?

8 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Newborn male is scheduled for a circumcision. he is sterilely prepped and draped; a penile nerve block is performed. the circumc
Lisa [10]
54150

The patience is having the circumcision preformed with a ring device (other device) guiding you in selecting code 54150. It is inappropriate to code 64450 with 54150 since penile block is included and stated in code description
7 0
3 years ago
Other questions:
  • Plssss help me on this
    10·2 answers
  • Which of the following describes how the moons of Jupiter are similar to Earth? A)Jupiter's moons orbit Jupiter much like the Ea
    11·2 answers
  • Why are viroids not considered to be a type of virus?
    5·1 answer
  • What variables may effect the amount of energy needed by a living organism
    14·1 answer
  • Bone contains living cells and organic matter such as collagen, protein, and polysaccharides. However, much of the volume of bon
    7·1 answer
  • With the exception of sensory neurons, the role of a neuron's __________ is to carry information toward the cell body, whereas t
    8·1 answer
  • Why do lunar and solar eclipses not happen every month
    11·2 answers
  • If capital D = the allele for dimples, and lowercase d = the allele for NO dimples, what percentage of the offspring will show h
    9·1 answer
  • What is extracellular matrix ? in simple words pls​
    12·1 answer
  • In 2006, an Ethiopian researcher announced the discovery of well-preserved 3.3 million-year-old fossil of a young female hominid
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!