1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gizmo_the_mogwai [7]
3 years ago
6

8) Each time a molecule of glucose is completely oxidized via aerobic respiration, how many oxygen (O2) molecules are required?

Biology
1 answer:
11Alexandr11 [23.1K]3 years ago
3 0

Answer:

C) 6

Explanation:

The balanced equation for aerobic cellular respiration is:

C₆H₁₂O₆ + 6 O₂ ----> 6 CO₂ + 6 H₂O + Energy (ATP)

For each glucose molecule that's oxidized, 6 oxygen molecules are used in order to produce ATP. Carbon dioxide and water are byproducts of aerobic respiration..

You might be interested in
What species accepts electrons in the final step of the electron transport chain?
Ber [7]

Answer:

Oxygen

Explanation:

Because it’s oxygen I don’t know ‍♀️

8 0
3 years ago
Which of the following is not true concerning the layers of the Earth?
MariettaO [177]
(C.) The layers of the Earth are uniform in thickness

This is untrue. The mantle is far large than the crust and there are other large size differences.
7 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Which of the following best describes the influence of latitude on climate? A. Earth's climate zones are produced by the equal d
mixas84 [53]
D. Polar regions receive less solar energy and heat per unit area than tropical regions 

Less direct sunlight means that there is less concentration of direct solar rays. This would influence temperature and would ultimately create weather, and since this pattern continues of switching direct ray latitudes, this would create climate zones all over the Earth, and similar ones with similar latitude and terrain.
7 0
3 years ago
Read 2 more answers
what is the major environmental factor limiting the numbers of autotrophs at great depths in the ocean
qwelly [4]
Sunlight doesn't reach quite as well in deeper parts of the ocean. Therefore, the autotrophs cannot use photosynthesis to make food.
4 0
3 years ago
Other questions:
  • In anaerobic atp production, a byproduct of glycolysis is
    6·1 answer
  • Nutrients form digested food move from the digestive system directly into the
    5·1 answer
  • Receptor molecules on the surface of cells bind specific molecules called, in general, __________
    14·1 answer
  • How would you compare the x and y chromosome in regard to size and number of genes?
    9·1 answer
  • The cell walls of plants and algae have openings, or channels. How is this structure most likely related to the functioning of a
    8·1 answer
  • The failure of the human body to effectively maintain dynamic equilibrium can result in ?
    6·1 answer
  • A body of air that has the same temperature, humidity and air pressure throughout is called
    15·2 answers
  • Which describes the risk of biotechnology?
    15·2 answers
  • What is the function of the seed (fertilized egg)?<br><br> Q#21 on pic
    10·1 answer
  • A female has a brother who is color blind and a mother who is not.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!