1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DanielleElmas [232]
3 years ago
5

WILL MAKE BRAINIEST) Using the image and your knowledge of spectroscopy, what ELEMENTS are found in the sun?

Biology
1 answer:
FinnZ [79.3K]3 years ago
4 0
Omg I have the exact same question
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Identify the object made from a nonrenewable resource
EleoNora [17]

Answer:

Plastic vase

Explanation:

3 0
3 years ago
Read 2 more answers
Which partly explains why the domestication of animals tended to increase the human food supply?
Alenkinab [10]

Answer:

A

Explanation:

Before domestication of animals, these animals were wild and early humans used to hunt for food. The hunting process  was not always successful and took a lot of energy from the body. Domestication of these animals made food available and other conveniences. An example is cows that emanated from the domestication of wild aurochs. They provided the milk and meat for humans and also labored in the farm in the cultivation of domesticated plants.

6 0
3 years ago
Earth's sysems can interact quickly or over long periods of time. Give two examples of how Earth can change quickly and two exam
VARVARA [1.3K]
Quickly... this is a harder one, because all of possible answers are the result of interactions over a long time. However, these change the surface of the earth the fastest
1.) Volcanoes
2.) Flooding

Over a long time
1.) Through the rock cycle... earthquakes, mountain forming, etc.
2.) Melting, or forming of ice... changes sea levels
3 0
3 years ago
What cell contains what percentage of the required chromosomes
likoan [24]

Cells with the full set of chromosomes are

diploid somatic cells.

7 0
2 years ago
Other questions:
  • The specialized tissue in the root that functions in food storage is the
    9·1 answer
  • Where is the energy in the products of photosynthesis?
    13·1 answer
  • FOODS RICH IN<br>CARBOHYDRATESfood rich in carbohydrates and fats and proteins ​
    5·1 answer
  • What is a cell? Why are cells important for living things?<br> Plz
    7·1 answer
  • What rule is used to join the free nucleotides to the exposed bases of the DNA?
    13·1 answer
  • Antibiotics can be used to treat
    11·2 answers
  • Which of the following nonmetallic mineral resources is use both as A building material and and industrial mineral
    14·1 answer
  • PLS HELP!!! best detailed answer gets brainliest!
    10·1 answer
  • Sickle cell anemia is a mutation that results in abnormally shaped blood cells. Which two of the following molecules are changed
    5·1 answer
  • The type of human activity on earth is determined by the weather and climatic conditions.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!