1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
2 years ago
5

PLEASE help and explain why

Biology
1 answer:
hram777 [196]2 years ago
4 0

Answer:

Your answer is d.

Explanation:

You might be interested in
Why is it useful for an ecologist to identify the keystone species of an ecosystem?
RideAnS [48]

It is useful for an ecologist to identify the keystone species in an ecosystem because the keystone species is important to maintaining the stability of an ecosystem, and any changes in the keystone species population shows that there is changes in ecosystem health.

6 0
3 years ago
Are mutations always bad? explain your answer
mr_godi [17]
No.

This is because mutations not only help a species survive in certain conditions, but also allows diversity within a population. For instance, a bug species can develop a mutation to bug spray, allowing it to survive through its prey or killers. Therefore, ultimately benefiting and helping the species.

Hope this helps!
7 0
3 years ago
__________ fats or lipids form animal body fat that is used for stored energy and insulation.
rusak2 [61]

c. saturated, thats the one that helps animals store energy and insulation                                    

6 0
3 years ago
Read 2 more answers
Discuss how human activites affects the phtsical or the biotic envioment of organisms
Salsk061 [2.6K]

Answer:

Besides wildfires, human settlements affect neighboring ecosystems through biotic processes, including exotic species introduction, wildlife subsidization, disease transfer, landcover conversion, fragmentation, and habitat loss.

8 0
2 years ago
If we were to compare the cells in the plant leaves to the cells in the plant roots, we would expect the leaf cells to contain m
Lyrx [107]
The leafs would contain more Chloroplasts, that is where photosynthesis occurs!
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these is a chemical property of a sheet paper
    8·2 answers
  • Materials are transported within a single celled organism by the
    5·2 answers
  • An adolescent girl is going to be treated for a severe case of acne vulgaris. A pregnancy test should be done prior to the adole
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Once the dye had been applied to the shirt, all that remained was to ______ it.
    15·2 answers
  • Plant cells that are specialized for cell division are most likely found In which part of the plant?
    8·1 answer
  • Commissures, including the corpus callosum, are Group of answer choices pockets of oxygen found throughout the brain. brain area
    7·1 answer
  • Marine phytoplankton are not found at great depths in the ocean because of the lack of​
    8·1 answer
  • What would happen if you did an experiment in which the iodine solution was placed in a baggie, and the starch solution was in t
    15·1 answer
  • What is given to wood whose normal cells have been replaced with mineral deposits?? please help​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!