1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
3 years ago
8

HELP ME WITH THIS FAST PLEASE!!THANK YOU ​

Biology
2 answers:
ozzi3 years ago
7 0

Answer:

There would be increase in carbon dioxide in the atmosphere

Explanation:

JulsSmile [24]3 years ago
4 0

Answer:

There would be increase in carbon dioxide in the atmosphere

Explanation:

Without the thousands of trees to hold the carbon dioxide and turn it back to oxygen, the CO2 is rather just sitting there in the atmosphere.

You might be interested in
Please help i have no idea.
amid [387]
The answer is D, ADP gains a phosphate and that is used to convert to ATP with a product of ATP and water
5 0
3 years ago
Read 2 more answers
¿como se llama el aparato digestivo que es un saco con un solo orificio que hace de boca y ano?
pychu [463]

Answer:

canal alimenticio

4 0
4 years ago
What do you notice about the two molecules?
anastassius [24]

Answer:

If it's in the table, it's an element! Atoms can join together - they form bonds together - to make MOLECULES. For example, two atoms of hydrogen hook together to form a molecule of hydrogen, H2 for short.

It would have been a little helpful if you added a picture but I hope this is helpful.Thank you!

Explanation:

7 0
2 years ago
Read 2 more answers
Compare and contrast the contributions of Neel, Pauling, and Ingram to our understanding of the genetic and molecular basis of s
taurus [48]

He demonstrated that SCD and sickle cell trait were due to the presence of abnormal 8-globin polypeptides in red blood cells. He demonstrated that the electrophhoretic mobility of B-globin from patients with SCD was different from that of healthy individuals. He demonstrated that both parents of multiple patients with SCD had low levels of sickled red blood cells. He hypothesized that SCD was a recessive trait and that the parents of patients with SCD would be heterozygous carriers. He demonstrated that the difference between B-globin polypeptides in individuals who were healthy and those with SCD is an amino acid substitution. He performed a peptide fingerprint analysis on B-globin from individuals with 84 84 and 89 88, which identified the segment of B-globin that was changed by the BS mutation. James Neel Linus Pauling Vernon Ingram

hope it helps..

7 0
3 years ago
Where are endocrine glands found?
NISA [10]
They are found in the body
6 0
3 years ago
Other questions:
  • How does human activity affect earths freash water resources
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the neurons is a touch receptor known as a merkel disc?
    9·1 answer
  • Which organisms are prokaryotes?
    10·2 answers
  • How do external regulators respond to events outside of the cell
    9·1 answer
  • Which organelle's function is CORRECTLY described?
    6·1 answer
  • Which wave is carrying the least energy, the top wave or the bottom wave in the picture?
    11·1 answer
  • How are binary fission and mitosis similar
    13·1 answer
  • Based on the image of rock layers and fossils what can you conclude?
    15·1 answer
  • Apply: Under Mode, select Crime scene 1. This is a sinister case of sabotaged stew in a swanky restaurant. Use the procedures yo
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!