1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
g100num [7]
3 years ago
7

Give one other process that use oxygen​

Biology
2 answers:
e-lub [12.9K]3 years ago
5 0

Answer:

Plants and animals use oxygen to respire and return it to the air and water as carbon dioxide (CO2). CO2 is then taken up by algae and terrestrial green plants and converted into carbohydrates during the process of photosynthesis, oxygen being a by-product.

Explanation:

goldenfox [79]3 years ago
4 0

Answer:

breathing

Explanation:

when you breath you breath in oxegyn

You might be interested in
What is a least common multiple?
Contact [7]
A least common multiple the lowest common factor that the two numbers have in common. Hope this helps. :)
5 0
4 years ago
What is peristalsis? how does it work in the esophagus?
lana [24]

Answer:

Peristalsis is part of the food digestion process. it's a helpful function we have

Explanation:

4 0
4 years ago
What happens to the air around your vocal cords when you speak?
lidiya [134]
D. It expands and contrasts

Hope this helps!!
6 0
3 years ago
What is a gas that plants take in through small holes in their leaves for the process of
never [62]

Answer:

Carbon dioxide

Explanation:. Carbon dioxide enters through tiny holes in a plant's leaves, flowers, branches, stems, and roots. Plants also require water to make their food.

3 0
3 years ago
_____ is the study of living or once-living things. This includes the human body.
Andreas93 [3]

The study of the lives of early human communities through the examination of their physical remains. Objects made by humans that are unearthed by archaeologists. ... The study of the earth, especially it's rock forms.

6 0
3 years ago
Other questions:
  • A dog breeder wants to show prospective buyers that his dogs are pure breed.which kind of model could he use
    7·1 answer
  • €¢ draw and label a generalized open circulatory system and a closed circulatory system
    11·1 answer
  • Which of the following is NOT prokaryotic?
    12·1 answer
  • During which phase of mitosis do the chromatids become chromosomes?
    5·1 answer
  • Consider the two biomes: tundra and desert. They are alike in some ways; different in others. The plants that live in both biome
    13·2 answers
  • Which of these are root causes of lung disease?
    15·1 answer
  • Referring to plants that produce offspring of the same variety when they self-pollinate.
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Why earth is considered a closed system
    8·1 answer
  • The force of gravity...
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!