All categories

2 years ago

What is true about cellular respiration?

Biology

1 answer:

sweet-ann [11.9K]2 years ago

4 0

Answer:

Cellular respiration can occur both aerobically (using oxygen), or anaerobically (without oxygen). During aerobic cellular respiration, glucose reacts with oxygen, forming ATP that can be used by the cell. Carbon dioxide and water are created as byproducts.

Hope this helps, have a wonderful day/night, stay safe, happy holidays, and merry christmas!

You might be interested in

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

Can some one help???

STatiana [176]

Answer:

what is it you need

Explanation:

8 0

3 years ago

Read 2 more answers

The stages of mitosis were originally defined by cellular features observable through a light microscope.

Brrunno [24]

Answer: TRUE

Explanation:

The cell division that takes place during the growth and development of an organism is in an as MITOSIS. Mitosis takes place in somatic cells that is, body cells that are not involved in the production of gametes. The difference stages of mitosis were originally defined by cellular features observable through a LIGHT MICROSCOPE. These stages includes:

--> PROPHASE: when viewed under a light microscope, each chromosome shortens and thickens and is seen to consist of two chromatids. The Centriole begin to separate.

--> METAPHASE: The nuclear membrane disappears, a spindle forms, the chromosomes line up across the middle of the cell and become attached to the spindle fibres at their centromeres.

--> ANAPHASE: The sister chromatids are pulled apart to opposite ends of cell as the spindle fibres contract.

--> TELOPHASE: A nuclear membrane forms around each set of chromatids, and the cell divides into two daughter cells.

4 0

3 years ago

Please help I only have 34 minutes

g100num [7]

Answer: frontal lobe

Explanation:

3 0

2 years ago

BRAINLIESTTTT ASAP!!!

hram777 [196]

Presidential Reconstruction

In the spring of 1865, the Civil War came to an end, leaving over 620,000 dead and a devastating path of destruction throughout the south. The North now faced the task of reconstructing the ravaged and indignant Confederate states. There were many important questions that needed to be answered as the nation faced the challenges of peace:

Who would direct the process of Reconstruction? The South itself, Congress, or the President?Should the Confederate leaders be tried for treason?How would the south, both physically and economically devastated, be rebuilt? And at whose expense?How would the south be readmitted and reintegrated into the Union?What should be done with over four million freed slaves? Were they to be given land, social equality, education, and voting rights?

4 0

3 years ago