All categories

3 years ago

What type of carbohydrates does Class Trix cereal contain?

Biology

1 answer:

sergey [27]3 years ago

6 0

Answer:

Trix cereal contains simple carbohydrates, which differ from complex carbohydrates in that they are easier for the body to break down. However, this is not necessarily a good thing. Simple carbohydrates are often too easy for the body to break down, resulting in a boost of energy, then a sugar crash. Try something like an apple or a banana instead, for a good source of complex carbs.

You might be interested in

The part of the nervous system that is used to help you think through situations is called the:

shusha [124]

The part of the nervous system that is used to help you think through situations is called the central.

Answer: Option C

<u>Explanation:</u>

The central nervous system comprises of the spinal cord and the brain. It is given the name as Central nervous system as it accelerates thinking and passes information. There are some important reflexes that mainly involve the spinal cord and central nervous system like thinking through the situations.

It controls our movements, thinking and acting. The central nervous system send signal from one cell to another cell. It gathers information from all over the body and transmits it to the other parts.

7 0

4 years ago

A protein is 300 amino acids long. Which of the following could be the number of nucleotides in the section of DNA that codes fo

ira [324]

Answer:

i do not know

Explanation:

aye

8 0

3 years ago

Read 2 more answers

I need help on questions 54-57

VladimirAG [237]

How would u approach the first one, #54

7 0

3 years ago

What kind of symbiotic relationship is showm between Dori and Marlin

OlgaM077 [116]

<span>The kind of symbiotic relationship between Dori and Marlin is mutualism. This kind of relationship is where two different organisms exist together and they benefit one another. Some other examples include pollination. Lastly, some of these interaction play a key role in terrestrial ecosystems. </span>

8 0

4 years ago

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0

3 years ago